Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RGS2
Systematic Name YOR107W
Strain S288c
Description Negative regulator of glucose-induced cAMP signaling; directly activates the GTPase activity of the heterotrimeric G protein alpha subunit Gpa2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RGS2 YOR107W
TTTCCGTTAACTGTCATTTGCCTTACTGTTGCTTAACGGCCGCCAACCGTTATCAAGAAA
CAAAACATTGTATGCGTTGTCTTCTAAATGAACCTTGTGGGCCCTGATAAACATAAGAAC
GTGTCTGGCTCGGAAGTATTTATCTTATTTCAATTTTCGCTTTTGCAGAACATCCTTGCC
TGTCACTAAGATAAGGACAGAGCGTGGATTAATAAAAATGGCAGAATTTCTCGGCAAAAA
AAGAAATCATGCATAATTACCTCGATGTGTACGTTATTGCGGGCACGATCCTGTCGCTAC
GGCCTGATAGTAGCGGCTATTCTGCTGGCGAAAATTTTCAGCAGTTTGAAATCTTACTGT
GGCGTCCCGGTCCAGCCGAGATGACATCTAACTAAGAAATGTCCGCTGCGGCACACCCAC
GCCGTTGCAGCTAAAGTCGCGCACCAAGCACAGACCTGCTGGAGAATGAGGAACAAGGTT
GCGTTAAATGCTTCGGGAAGAACTGCCGAACCGAACCGCTAGAAAAGTGCGCAGGTACCC
CGATCGAAGCGGCTCGGCGCTCATTTTAGCACAATCAGAAAAAGGAAATTGAAAGAAGAA
AAAAAAAACATAATCATTAACAATTCTTTTCTTGAGATATACGTATATATGACGTCGTCA
TGTAGTATCTCTTTCGGGATACCCTTTGTAAACGTCCCTTTGTGGAGATGAAAAAAAAAC
TTGCTGAATAAAGATAGTTAAGGCGCTAGTAATCAAATTAATAACATATTATACCACATC
ACATCTATACCATTTCCGTTGCACATTGCTTGAACCAGTTGCCAAAATTGACTAAACGGA
TTTTTACAAAGTCAACGGTGATCACTAAAAGCAAACAACTCAAGCGACGAGGCAAGGAAA
GAGAAGAAAAAAAAAATATTACATTGGCTATATAAATATCAAAACATCTTAGGTAAGGCA
CCTTTGATACATAAAACGAAGAAAATTCAGCACATGCCAG
Chr coordinates Chr XV from 521353-522282
w3c xhtml validator w3c css validator