Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LEU9
Systematic Name YOR108W
Strain S288c
Description Alpha-isopropylmalate synthase II (2-isopropylmalate synthase), catalyzes the first step in the leucine biosynthesis pathway; the minor isozyme, responsible for the residual alpha-IPMS activity detected in a leu4 null mutant
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LEU9 YOR108W
CGATCGCACTTCTCGGCCAAGCGAGTCCTCTTCCTCACTCAACACTACCAGCTCGACCTA
CAAGAATACCAGCACTAGAAATCTGCAAAAACCGCAAAATACAGGAATTCTCAACTCGGG
GAAAGGTTTATTGCAAAAACTTAACTTTGTTAAAAAACGGAAATCTTTCAAACAGCCTTC
AGGCGTCATTTGTAGCCATTATAACAGCAATGTTCAAAACCGTTTGAAAGGACAAAACAG
TCATCAACAAAGATAGCCTCTTCATCATCTGTGGAGACACAAATATCTTCATCCTCATCG
CCATTACCCAATAAAGCGATCGGTAAAAATGAAAAAAGCGTTGAAAACGGCTTTAAAAAG
CTAAATTTGCATGATATCAGTTAATCAAGATTAGAACTTTGATTAAGTAGAACAACGATA
GAAAATCCGCTTTTCTGGCTAGTTCCCTCGTTTCATATTAATTCATTTCACACAATTTAC
TTCATTTCATCACGCTCATATTGTTTGTAACTTTAGTTTTTATTTAATTTTACGTACATG
ACACTGCATATAATTATTTCACAGGCATTTAAAATAAGAGCATTGGGCACAGTCTTCTTT
TATATGTTGTCATATTCAAACACTAAACATTTATCTGTATAGTAATTAATGTTAGCTCTT
CCTTCTGCATGGCGCTTGTTATATACTTCATTCGTCTATTTTGGTGCCGCGCGCCATCAT
GGTCCGGTAACGGTCGTAGTGAATGACTCATATTTTTCCATCTCTTTCGGCCTTGCCAAA
AAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAATTAAAAACGATGTCCAGAATCACAACT
ACAACATAGTTTTGCCTCTTACTGGCTTGATTGGAAGTTAGCTGTTAAATTTCAATAATG
CCTTACTTTACTCCACGAAATCACAATCCTTGTTTTCGGCTTATAAGGGTCTTCTCCTTA
GGATAATACTATCGGCACATTATCATTTAGCCGCGTAGCC
Chr coordinates Chr XV from 523027-524841
w3c xhtml validator w3c css validator