Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UBP2
Systematic Name YOR124C
Strain S288c
Description Ubiquitin-specific protease that removes ubiquitin from ubiquitinated proteins; interacts with Rsp5p and is required for MVB sorting of membrane proteins; can cleave polyubiquitin and has isopeptidase activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UBP2 YOR124C
ACACACCGAAAAACCTGAGCATGCTCCCAAGTGTCAGAATTTATCAGATGCTCAGGCTGC
ATTTTTGGACCGTGTTATTCGTGTAGATCAAGCTGGCGAATTAGGTGCAGACTACATCTA
CGCTGGCCAGTACTTCGTGTTGGCTCATAGGTACCCTCACTTGAAACCTGTGCTAAAGCA
CATATGGGACCAGGAGATACATCATCATAATACTTTTAACAATTTGCAATTGAAAAGGAG
AGTCAGGCCTTCCTTATTAACGCCTTTGTGGAAGGCAGGAGCCTTTGCAATGGGGGCTGG
TACCGCATTGATTTCTCCAGAAGCAGCTATGGCTTGTACTGAAGCTGTCGAGACAGTAAT
CGGAGGGCACTACAATGGCCAATTGCGAAACTTGGCCAATCAATTCAATTTAGAAAGAAC
AGATGGAACAAAGGGTCCAAGTGAGGAAATCAAATCCTTAACTTCTACTATCCAACAGTT
CAGGGATGACGAGCTAGAGCATCTAGACACCGCTATCAAGCATGATTCGTATATGGCAGT
TCCATATACAGTTATCACTGAAGGTATTAAAACGATTTGCAGAGTAGCTATATGGAGTGC
CGAAAGAATTTAACCACCAGAAAGTGGCATACATCAGTCGCGTTATGCCAGAAAAGGAGA
ATTGAAAGGAAAACGGTTTGATAAATGTCCTAATTAAACTATCATGTATAAAATTATGTA
TCATCCTTACGCATTTTAACGCTATATGACCAATATGACAGGAATAGATACACTGTCTAT
AATTATGTAAATGGGGTATGGGTTCATAGTCTAAGGGTGAGTACAAACTGGATCTTTAAC
AAGAGTAACAGTTAATTAGAGCAAAACTATAGTACATATAGCTTGAAAAAAACAAGCGGC
TTGCCATTGGAAGAACATTGCATAAAAACGGGGCCACTGCTAATAATAAAGTGGTAATTA
AAAAGAAAGCTTTTGTTCAAGGTTAAGAAGGTATAAGGAA
Chr coordinates Chr XV from 558642-554824
w3c xhtml validator w3c css validator