Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ORT1
Systematic Name YOR130C
Alias ARG11
Strain S288c
Description Ornithine transporter of the mitochondrial inner membrane; exports ornithine from mitochondria as part of arginine biosynthesis; functionally complemented by human ortholog, SLC25A15, which is associated with hyperammonaemia-hyperornithinaemia-homocitrullinuria (HHH) syndrome, but HHH-associated variants fail to complement
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ORT1 YOR130C
TGAGAAATAGGTGAATTTTCGGGATAATCGTTAGGATTTCATTATTGTTAAGGGCTATAA
TTTAGGTATATCGAATATACGAGAAGTTCTGCACGATGATATAGGGATCCATAAAGGGAA
CCAATATTTCTACGTACCTGTTACTTCTCCCTCCATTTTATATTTTTCATCATTTTATGA
CGTTATCAAATCCTTGCATTTCAGTTGCCATTATACTTTACCATTGTTTTTCGATTTTAT
GTCATCTTCTTACACCGTATGACAATATACCAGTAGTATGAATATCAGTCGATGAGTGAG
TTGATTTTTATTCGAACATACACGTTTTAACGTGAATGTACTAAACTGCTAACTGAGCAT
TTCGGACAGTGCTGAAAATAAGTTAAAGATCTACGCTTTGGTAGTTATGTATACGAGTCA
TACAATTCGTCACATTAAATGTATAGTATCAAAGACAGTATTATCCACACTTAATCTTCA
TTAATACTTATCAACAAAAATGAAGCACTCATCTGACTATATTTATATAATATTGCCGAC
CAAAATCCTTGTGTTTAATTCCAAGTGATTTAGCACCAATCCTATTCCATCCATGCAGGT
GCTGTTGCTGCTGGATCCGTGTTTTTGACCAGTCTTAATGAAGCACAACAGCAGCCTACC
CTTTTTGTGGACCATATTAATGGATACAATGAGTACTTAGCACGAAGAAAGCGTAGCATT
GTAGTTTCATCGTTGCAACTTAGTCCTAGTACGTTCCAGTTCTGCATCGTGACTCACCTT
GAGCTCGAAAAATGTGACATATACGTTTTCCGCTGTGGCCGCTGTGGCCGCAGCGTCAAG
AATCGCCAATGATAAGTTCTCTGCTCCTGGCGTCGATAGATTCAGAAAAGTGTGAAATTA
TCGAAGCACGGGTATAGTTAATTGTTAAAGCGTAGATGCTTTGTCGTAGAAACTTTTCTT
TAACCTATAGGGAACTCAAATTCTGGAAGGTCAACGTATA
Chr coordinates Chr XV from 570807-569929
w3c xhtml validator w3c css validator