Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BAG7
Systematic Name YOR134W
Strain S288c
Description Rho GTPase activating protein (RhoGAP), stimulates the intrinsic GTPase activity of Rho1p, which plays a role in actin cytoskeleton organization and control of cell wall synthesis; structurally and functionally related to Sac7p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BAG7 YOR134W
CGTAAGAGACACGGTATGAAGGAAGAAGTTCCAGGCTGGCAAGAATATTACGACAAATTG
TAAGAAGTCTAAATGAGAAAAGGTGGTTCTGTAAGAGCAAACCTTACCGCCTTATGATCT
TTTTCATTTATTCTCTGCTTTAAAATTTTGTCGTAATAAAAATAGTATGGTAATAGACTT
ATATATTATTTTCTTACACATTTTTGTCATATAGTTATATTCCGAATGTTTACAATCGAA
CCCATCATAAAAATGGACCTTTTCGTATTACCGCCCCCTTTGTAGAGGGGGAGGAACGGC
AACTTCTTGACTATTACGACGTATCACCACCCCGTTAGATATACTATGGAAAAAACTATT
AAAAACCATTATAATTCATTAATGACATCGGTCCTGAGGTAGTATTACGTATAACTTACC
TGGCTCTTGGTCATAGCTTTTTATCCGTTTACGAAAAAAGGAGAAGAAGATTGGGCTTCC
GCGGCTATTGTTTGGTTTATACCCCGCCGTATGTTGGTGCTTCTATAATTAGAGCGAAAT
AGGAAATACAAAAAATCCTTGGAGGGGAGGACCAGCCTCATCGGGCTAAAACTCCCTCAA
AACCGGAGGGGCAACCAAAGTATATATCTCATTATGGCCGATACTTCTAGAGGCGCACTA
ACAGAAGCACCTCAGCCCCTGCAGGTGAAAGAAAGAGGTAATTAATTTTCCGGTTACTTA
CTTTCTCTCGCTATTGGGGAAAGCGTTGGTTCGAGGCGTTGAGGTCGAAGACAATCATTG
TTTTCTTCTTATTTAAGTACATCTTTAGAAGAAAATTACACAACTGGAATGAGTAAATCA
ATACTTGCTTTGTGTTCCCATTGTTAGATACTCTTGTTTTAGCATGTGATAGCAGTATAT
AATATAACCTGCAAAATAATCGAAACGCGTACACAGGAAAGAGTACATAAATAACCATAG
TATATTTCTGGACATATCTTATTACACAACATAAAATAGA
Chr coordinates Chr XV from 578564-579793
w3c xhtml validator w3c css validator