Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PNS1
Systematic Name YOR161C
Strain S288c
Description Protein of unknown function; has similarity to Torpedo californica tCTL1p, which is postulated to be a choline transporter, neither null mutation nor overexpression affects choline transport
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PNS1 YOR161C
GCTAAGTCGAGGCAATCTCGCGGCGCGACTACTTTGAAGCCTTTTTTTAGTTCTTTTTTA
TGATCAAAATGTTTATATAATTACCCAGATTATCAACCCACTTCGATGATGGGCCGCACC
TGACAGAAAAAAATGAATCAACTGGCTACTAAAGATGGTACAAAAGTTCACTTTATTCAG
ATATAGAATTGCTGAATCGCTGCTTACCGCCATACGCTTGACTACTTTTACACCCGTACA
CCACACATACAACCGTACGACTACTTTTCATGCAACAGCGTGCGTTTCGACATGTCTTAC
ACACGAGTAGATCATCCCACTGGAAAAATGGCTTGTCACCTGAGGCAGATTTTGGCAAGC
CCACTGTTTTTCGCAAATTATGTACTACATGCAGCCATTCACTACCCTTCGAGCGACATA
CGCGGCGACATCCTGTAGAGCAATGTTGTCCTTACCAAGACGTCTTGATGAAGGATAAGC
ATACGCGAAGAGATTTCCTCTCGGAGAGCCTGCAGGGAGCGGCGCACCTCGCCAGCGGAG
TTATCACACGTAATGGTACTGAGTGAGAGACCCCGCCCGACACCGCACGGCCATTTGCAG
AAAGAAAAACAAAGTCCACTACGGCTAATTACTGCAGAATGCTTTTTTTTCTTTTTTTTT
GTGGTTGGTATGTTCCCTTCTAACAGGATTCTTCCTTCGGTAGATCCTTGAGGGGTTTAA
GGGGTTTTCTGTTTGCGTAATGGCGTAATTGCCAGCTATATATAACATTATCATCACATA
TATATCCTTATACGTAGCTTGCCCTTATATATATATTGATATGCGGATATTCGTTGAATG
TAGTTCAGTCGTAATCGCTACTTATTGGTAATCATAGCAATTGAATGCTTCTATATTCCT
TTCTTACTTTTTTTAATTGCGCATTATAAAAAACTTGAAGGTGCATATTTCCGATTAGGG
CCATCAATAGTGACCATAATTATCGGTACATTAATACGTC
Chr coordinates Chr XV from 638558-636939
w3c xhtml validator w3c css validator