Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DDP1
Systematic Name YOR163W
Strain S288c
Description Polyphosphate phosphatase; hydrolyzes diphosphorylated inositol polyphosphates and diadenosine polyphosphates; has high specificity for diadenosine hexa- and pentaphosphates; exhibits endopolyphosphatase activity with a high affinity for polyphosphates, an activity also observed for its human DIPP homologs; member of the MutT family of nucleotide hydrolases
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DDP1 YOR163W
ATATTGACAGGTTGTTAAGTTTCTAGAAATGCATGTAGAACACATAGGTTTTTGCTGATC
ACAACGAAGTTTTCTCCTTCTGCAAAAGCCACAAGATTTTATAAGCTTGTTTCTCTTCTT
ACCGCTAGTAGAAGTTGGTGTTCCTGAGTTACTTCCATTGGCTCCACCGGCCGTACTATT
ACTATTATCGCTTGGCGGCGTAACGTTGGTGGCCTGGAAACTTCCCAACAAAGCATCGCT
TCTTCTTTTCATTGTGACGCTATTCTTATTGGCACGGCTGAGGGCAATAAACTTTCCCAC
TTTCTCGTTGATCTTGTTGTTCCTTTGATCTAACTTTTCTCTTGTAATTCCGAATTTTTG
GCGTTTTGGTAATTCCAAGGGGAAGTTGTCTATTACATACGTCTAGTGATGTGGAATACT
ATAAATGTCTTGGTATTGTTATCCTTTTCCCCGTATATCAGCCTCTACCCCATTAGTAAT
ATGGCATGGAACCTTTTAACGTTTTTCTAATTTCCGCGGATTTAACTCCGTTCACTATGA
TTTCTGCCAGTATGATACTGGCAGAAATCTACATTCGCTATATATAAAGAGGATATACTG
GTAATAACTACAGCTTCCATGTGAGCTTAAAACGATCATGCTCATCTTTCTTCATCTTGA
TAGAGATTGGTAATGCTGTCATACTCCCGTGATTATAAAGCAGAATGAGAAATATTGAGA
CAACCGTAAAAACAGCTACTGCCCAGAATTTAAACCTTCAAACTTCATCATCAGAAAGGT
ATACTGTGTAAATAATGCGTAAATAGTAGGAGCATGGTGTTCTCTTGTCGTTGAAAGAAC
ATCTGCGGCGAGCACGTGCGGCTTAATTCTCAAACGTCTCGCGGAGGTAAATAGTGTAAA
GGGAAGCCTCAACTTTAAGACATGAAATCACACTGAAATAACGCCTGAAAGGTCAGGAAC
AGTGAGTACGTAGGAGTATAAGAGCGTGGGGAAACACAAA
Chr coordinates Chr XV from 642741-643307
w3c xhtml validator w3c css validator