Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YRM1
Systematic Name YOR172W
Strain S288c
Description Zn2-Cys6 zinc-finger transcription factor that activates genes involved in multidrug resistance; paralog of Yrr1p, acting on an overlapping set of target genes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YRM1 YOR172W
TCTCTTGGAATTTTCATAACTTTTTTCCAGGATTTCTTCCACAGTACCAGAAGAAATGTT
CTCCTCTCCGGTATTTGCTCTCGATTTCCTAGAAACGTGATCTATTAACAAGGTTAATTT
TTGTGGTATAACATCATGGCCCTTGGGTACAGCAAAAGTTAACTCAATTAACTGTTGATT
ATCTTTTATCCCTAAAGATGGTGAGTTATCCTGTGAATCATCGGGAGACACCTTCACAGT
GTTCGTTTTTGTATCCCACTTGTCTTTTTTGGGAAATGACTGTGATTCGCTTACAGGAGC
CTTATCATTGCTCAAACTATGATTCTCAACGTCGTCATTTTCAGACGAAGAACTCAGATT
TTCCGTTTGAAAAGGATTCGAAGAAATTTTGCCATTATTGAAGCCTTTCTGACCGACATT
CACATATTTTGCGTTCAAAATTCTGTTGAACGGAATGGTAGTATTAAGAGGCAACAGTTC
CAGGGAATCATCCTCATCAAAAGAACCTCCATCAGAGCTCAAAGTTCCATCATCCAGACA
GGACAAGCAGCTCAACAAGGATAAAGAATCTCCGCTTCTGAGTTGACCATGCTTATTGAA
CATATGGTGTGATTGCGATTTGATCAATACACCTTCATCGGTCAAGATAGCCCTAAGTTT
TTTCTGCACCACCATTATCTATAGTAGATTCTTCGCGTACTTTTCGCTGCTAGACTTTTG
TGTTCTTGATAACCTCCAGGATCAGTACGTTAGACAAGGGAAAGTATCAGATGGGTTAAA
CACGAATTTTCACCTTCTTGTATGCCTTTCTTCCGTTAAATCATCTTTTTGCTTCAAGAC
CCTTGCAGCACGTTTTTTTCAGGCTCGGCAGTAGGGTGACACCCATGGTTTACAAGGCGA
TAAAATGACAAATGCCAGGTGGTATTGTAATAATAACGGCAAGAGTATAGAAAGTCAGAG
GGGAAAGCACATTGAATGGTCCTGGTAAAGGGAGTTGTTA
Chr coordinates Chr XV from 654210-656570
w3c xhtml validator w3c css validator