Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DCS2
Systematic Name YOR173W
Strain S288c
Description m(7)GpppX pyrophosphatase regulator; non-essential, stress induced regulatory protein; modulates m7G-oligoribonucleotide metabolism; inhibits Dcs1p; regulated by Msn2p, Msn4p, and the Ras-cAMP-cAPK signaling pathway; mutant has increased aneuploidy tolerance; DCS2 has a paralog, DCS1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DCS2 YOR173W
GTTACAACAACTCCAAGACGAATTGAATGGGTCCTATTCGCTCACTGACAATGTAAATAC
TCCAATCGATCCCAGTTTAAGTGACCTGGGCGTCACAAGCGCCAGTCCATTGGCGGGAAA
TTCTCCAGGATTACCCCCGGAGGAAGTGCGAAATAACAGCGAAAACGCTTCGCATAACAA
TGAAACTGGGCCAATTGAGACTGAACTGGCACAGACAATATCCAACGAATTTTGGACGGC
GTACAACCTTGGCTGGGAGGAACTAATGAGTCAGCCAGATTATAAATATTTATTTGATAC
GCAGTAGAGGAGAAGTTCTTTTACAAAAAAACATGCTTGCGACAGCAGCTAGATAGAAAA
CTTGCATATTGTAATGGAAGACAGTCGAGAGCAAGCCATTGGCTTGGACTTGCGCTTGGA
CCTATCTTTCGGACCAACTATTTAATGATTAGTAAGACAAAAATGACATTTAAGCATCTA
TAAAATAAGAAAAATAAAAAAATGAAGGGAAAAAGCTAAACACTAACTTCTTGACCAAAC
AAACAAGGAAAAGCCAGTAATTGCGTGAACAAAAGGCACCTGCAATTGTTCTGATGGATG
TACTTTGTCCAACCTATTCTGCAAGAAAAAGAAATCAACTCCAAAGAAGTATGGAGCTTA
CTGGCACTCTAGCCTCCAAAAGCTGTTAAAGTGTTCATTCGATTGTCAAAAATCTTCCCC
ATAATAATCACCCACCTCAACAAAATACTTCCACTTAATTATTGATCGATTAGAGCTAGC
GTCAGTGATTATATGCTAGTCCGAAAGGACAGCCCCATGACAGCGGCCGCGCAGACGCCT
AGGGGGGAAATAAGGGGTGACAATACCAATGAGTATAAAGGCAGAAAGAAGAGAAACAGA
AGCACGGGGGTTTCGTTTGGTCTTCAAATATATGTTAGGTCGGTACCTTTTCATTGCAAA
ATTGAAAAGATTTGAGCGTGTAAAAGTAAAAAAATACATG
Chr coordinates Chr XV from 657264-658325
w3c xhtml validator w3c css validator