Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MED4
Systematic Name YOR174W
Strain S288c
Description Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MED4 YOR174W
AACAACATTCTTTACGAGGGCGCCGAGGATGATAGAGTTGTTTATAAGGAATACAGTAGC
AGGAATAAAGAGGATGGATTCGTCATCTTGCCCGATATGAAGTGGGACGGAATCAACATT
GATTCGTTATACCTGGTCGCGATCGTGTACAGGGACGACATCAAATCTTTGAGAGATTTG
AACCCAAACCATAGAGATTGGTTAATTAGACTCAATAAGAAGATTAAGACCATCATCCCC
CAGCACTATGACTATAATGTAAACCCGGACGAGCTAAGAGTTTTCATTCATTATCAACCT
TCATATTACCATTTTCATGTCCATATAGTGAATATAAGGCATCCAGGAGTAGGCGAGGAG
AGAGGCTCCGGAATGACAATACTGTTGGAAGATGTTATAGAAGCGTTGGGTTTCTTAGGT
CCTGAAGGTTATATGAAGAAGACGCTTACTTATGTCATTGGTGAAAATCATGATTTATGG
AAAAAGGGCTTTAAGGAAGAAGTTGAAAAGCAACTGAAGCATGATGGTATCGCAACCAGT
CCTGAAAAAGGCTCTGGGTTCAATACCAATTTGGGTTGAAGGTAGAAGAGCAGCACTATT
TTTTCATGTGCTGAACTTCAGGAAGCGCCGGCTTATATAAATGTCTTATTTAAATGTTTG
TGTATACATCTCAATGGATTTTGAATTTTAACATAGAATGCGAATGCACAGTAACATAGT
ACATTCAGTTGCTATTTTCCGTATAAGCTTTCTTTCCCTTATAGCATACATAGCCTTTGA
CGTATTGCCAGCCTTTTCAAAGAAATGCGAAAAAATAGTGCATTACCACCTACGTAAGGT
AGGCTGGAGAAAAAGATAAACTTTTGCATTCTCTGCTCACCATACCGCGAAGGAAAGTAG
TTATAACGTGTCCCGTTTTCAACAAGGTTTTCTGGTATATTGTTAACGGTGGAGAAAGCA
TCTAGTATCAATTACTTCCAGAGTACACACAACGAATGTT
Chr coordinates Chr XV from 658747-659601
w3c xhtml validator w3c css validator