Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ALE1
Systematic Name YOR175C
Alias LCA1, LPT1, SLC4
Strain S288c
Description Broad-specificity lysophospholipid acyltransferase, part of MBOAT family of membrane-bound O-acyltransferases; key component of Lands cycle; may have role in fatty acid exchange at sn-2 position of mature glycerophospholipids
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ALE1 YOR175C
ATGTACAATCCTGTGGACGCTGTTTTAACAAAGATAATTACCAACTATGGGATTGATAGT
TTTACACTGCGATATGCTATCTGCTTATTGGGATCGTTCCCACTGAATGCTATTTTGAAG
AGAATTCCCGAGAAGCGTATAGGTTTAAAATGTTGTTTTATCATTTCTATGTCGATGTTT
TACTTATTCGGTGTGCTGAATCTAGTAAGTGGATTCAGGACCCTGTTTATTAGTACCATG
TTTACTTACTTGATCTCAAGATTTTACCGTTCCAAGTTTATGCCACACTTGAATTTCATG
TTTGTTATGGGTCATTTGGCAATAAATCATATACACGCCCAATTCCTTAACGAACAGACT
CAAACTACCGTTGACATTACAAGTTCACAAATGGTTTTAGCCATGAAACTAACTTCTTTT
GCATGGTCGTACTATGATGGTTCATGCACTAGCGAAAGCGATTTCAAAGATTTGACTGAG
CATCAAAAATCTCGTGCTGTCAGAGGTCATCCACCCTTATTAAAGTTCCTGGCATATGCA
TTTTTCTATTCAACGTTGCTAACTGGCCCAAGTTTCGATTATGCCGATTTTGACAGCTGG
TTGAATTGTGAGATGTTCCGTGACTTGCCTGAAAGCAAAAAGCCTATGAGAAGACACCAC
CCTGGTGAAAGAAGACAGATTCCAAAGAATGGTAAACTTGCATTATGGAAAGTTGTTCAA
GGTCTTGCTTGGATGATTTTAAGTACACTAGGAATGAAGCACTTCCCCGTAAAATACGTT
TTGGACAAAGATGGCTTCCCAACGAGATCTTTTATATTCAGAATCCATTACTTATTCTTG
CTTGGTTTCATCCATAGATTCAAGTACTACGCTGCCTGGACTATTTCGGAAGGATCTTGT
ATTTTGTGCGGTTTGGGTTATAATGGTTATGATTCAAAGACACAAAAGATCAGATGGGAT
CGTGTCAGAAATATTGACATTTGGACCGTAGAAACGGCGCAGAATACGCGTGAAATGTTG
GAAGCATGGAATATGAATACTAACAAGTGGCTAAAATACTCTGTTTATTTACGTGTCACA
AAGAAGGGCAAAAAACCTGGTTTCCGCTCAACTTTGTTTACTTTCCTAACTTCCGCATTT
TGGCATGGTACCAGACCTGGGTACTATCTGACTTTTGCGACAGGGGCTTTGTACCAAACA
TGTGGTAAAATCTACAGACGCAATTTTAGACCAATTTTCTTGCGAGAAGATGGTGTCACT
CCTTTGCCTTCTAAAAAAATCTACGATTTAGTTGGCATATATGCAATTAAACTAGCATTT
GGTTACATGGTGCAACCATTTATTATCCTTGATTTGAAGCCATCTTTAATGGTATGGGGC
TCTGTTTATTTCTATGTTCATATTATTGTTGCTTTCTCATTTTTCCTATTCAGAGGACCA
TATGCTAAACAAGTTACTGAATTTTTTAAATCCAAACAACCTAAAGAAATATTCATTAGA
AAACAAAAGAAGTTGGAAAAAGATATTTCTGCAAGCTCTCCAAACTTGGGTGGTATATTG
AAGGCAAAGATTGAACATGAAAAGGGAAAGACAGCAGAAGAAGAAGAAATGAACTTAGGT
ATTCCACCAATTGAGTTAGAAAAGTGGGACAATGCTAAGGAAGATTGGGAAGATTTCTGC
AAAGATTACAAAGAATGGAGAAATAAAAATGGTCTTGAAATAGAAGAGGAAAACCTTTCT
AAAGCTTTTGAAAGATTCAAGCAGGAATTTTCTAACGCTGCAAGTGGATCAGGTGAACGT
GTGAGAAAAATGAGTTTTAGTGGTTACTCACCAAAGCCTATTTCAAAAAAGGAAGAGTAG
Promoter Sequence
Download FASTA
>ALE1 YOR175C
CTATCTTGGGGGTACGAAACTTAGCAATATATTTAGCAATTGTCTTCTGATACTTAGCAC
TAATGGGAATTAGGTCATTATCGGCAAATAATTGATACAAAAAATCATATGTTTCCTCAA
CTTTAGAGGGGCCACCCATGTTCATCAAAACAATTCCTGTGGGTGATCTCTTTTGTGCAT
TCTGCATGTTGAATGTAACCGAAAATGATCTTGTAATGGTCAGTTGTGATCTTCTTAGGA
AGGAACCTTGTGTACGGATTGTTCTGGAAAGCATTCTTTAAACGTTCTTTTTTTTACTGC
TAAATTTGTCCAAATAGCAGGTATGTGTTAAATATTTCTGTACTTCTTGTAAACCGACTC
AAGTGGAACACGAGAATTTACGCTTGTTTGGTGTCAAGCCAAGAGTGACCTTGACCGACC
AAAAGTATTCCTTCGCGTCCTCCTTCTTCAATCCCATATCCCCTACGAAAAAAAGCAGCA
TGAGAAAACGAAGGGCAGCAACTCCTTCGTCATATAAGGCTTACGGTGACCATTGAAGAT
TGGGCATGTCTAACGGCTATTGCCAGCGGAGATGTTTCAAGGCATCCTACACATGCTACA
TATTTGTAATTATTTTACTGAGTTTGTGTATATAAAAAACTTTTTTAAAAAAAAAAAATG
GCCAGCATCCTCTTTCATGTAAAGCTGTTGAACCTTCCTGAAATTTACTTCTAAAATTGT
TCAGTAAAACTGCTTGTTAAAAGTGCGAAGAGTTCTTTTTTAGCTTTTTTTGTCCTGCTG
TTGAGCTGTTTTGCTTTACTGTTCAACAAAACATTGAAGATCTTTCACATTGCGCGTCGA
AACCACAAACCGTCGAAAACAATGGTCATCTAAATAAAGGGTTCTTATTAAACAGATTTA
AAGCCAAGGACAAAATACAGGCACAGGTCAAGCAAGAAGACAAACCGCATACGCCAAGAC
AAACCGTGGTGATTTAATTCTGCTGCTGATCGCTTCCAAC
Chr coordinates Chr XV from 661674-659815
w3c xhtml validator w3c css validator