Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TUF1
Systematic Name YOR187W
Alias tufM
Strain S288c
Description Mitochondrial translation elongation factor Tu (EF-Tu); involved in fundamental pathway of mtDNA homeostasis; comprises both GTPase and guanine nucleotide exchange factor activities, while these activities are found in separate proteins in S. pombe and humans; rare mutations in human mitochondrial elongation factor Tu (EFTu) associated with severe lactic acidosis, rapidly progressive fatal encephalopathy, severe infantile macrocystic leukodystrophy with micropolygyria
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TUF1 YOR187W
TAAGCAAGCAACTTGTAATCAAGACCTCAATTCAAGGTTAGTTTACTCCTTCTCTCAAAT
ACTACGTAACAGATCTTATTGATGACTTTGGCTTTTACGACCTTCGCTATTTCCAAGATA
AACAATTCGTCCACGAATGAAGATTCTAAAGTCATGATACTGTGCGATGAGCATCACCCT
TTCGAGAAGGGTTACTTTAAGTCCGCCATACGAGCCTTCGGCAACAGCATTAAGCTAGGA
TTAATGGGTAACTCGCGACCAGAAGACGCAGCGTCCATATTCCAAGATAAAAATATTCCT
CACGATCTGACGACGGAAGAATTCAGGTTGCAGCTGGTCTGTATGGCTTTTTCCTGGTTC
ATATTTGGTCTCTTCATCGCCTGCTTACTACTTTGTATCACGCTTGTGCTAACATCGCGA
TATCCTGGAGAAAATGAAAACAAAGCCACGGAAGTTGTGCCATCCAGTAATATTGACGAC
GAAGAAAAGCAATTATCGCTTTCCGACATGATTTAGTACTACGTGGAAGAAAGGAAAAGA
AGCTGCTTTTCTCATTTAAAACATTTAGTTTATATACTTCGCCTCTGGAGGACTTTTCAA
TTTATGCAATATGTGAGCACTTCTCTATTCTCGATTAGGTCTCTGATATATACATATACA
TAAACATAAAGCAGTAAGTTGGGTCTATTATACTGACAACCCTGTTACCCGCATTGAAAT
TGACAGGCTGCCCATTGATTGGTCAGTTTCCCACTAACCCGCGCTGGAGCTGATTTTTCA
TATTTTTAAGGATTTTGTTTTAGCACCCATCCGACCTCAGTCAATATATCCTTTCGCGAC
CAGGCTTTCCTCCCTTTTGCTGCTAACTGGTTACAGATTTTCCTATTTTTGGTCATTTTT
ATCTTTGAAACTGATTAAGCTGAAAAAATTTGAGCTTCTTTGTTGTAAACTATTTTGTGC
TTTCAGTTTTATTCTAGCTCGACAAAGGTAACAGACAAAA
Chr coordinates Chr XV from 684030-685343
w3c xhtml validator w3c css validator