Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BFR1
Systematic Name YOR198C
Strain S288c
Description Component of mRNP complexes associated with polyribosomes; implicated in secretion and nuclear segregation; multicopy suppressor of BFA (Brefeldin A) sensitivity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BFR1 YOR198C
TTCACGAGCTGGGCTTCAATAACGAAAATATACCTCATGAACTGCCTTATGGTACGAAAA
CAGACGCTAAGAAGTTTCCTCTCGGGTTATATCTGGATGAAATAACTGACCCTCACAATA
TCGGTGCCATTATTAGAAGCGCTTACTTCCTGGGGGTTGACTTCATTGTGATGTCGAGAA
GAAACTGCTCTCCTTTGACGCCTGTGGTGTCCAAGACAAGCAGTGGGGCCCTCGAACTTC
TGCCCATATTTTACGTTGATAAACCGTTAGAGTTTTTTACTAAATCACAAGAAATGGGTG
GCTGGACGTTTATTACAAGCCACTTAGCTAATGCCACGTCAGAAAAATACACTGTTGGAA
AAACTATTAGCATGCACGATTTGAACGGATTATGTAACGAGCTGCCTGTTGTTCTAGTGG
TGGGGAACGAAAGCCAGGGCGTAAGAACGAATTTGAAGATGAGGAGTGACTTCTTCGTCG
AAATTCCCTTTGGTGGCATTGAGAAAGGCAATCGGGCCCCAGAACCCATTGTTGACTCAC
TAAACGTAAGCGTGGCTACTGCATTGTTAATAGATAATATTCTAACTTGTAAATAACCGT
CATATAAAGTAGCACAAACATACATAATAAGCCTATATACATTATACATGTGTAATGGTG
GTGGTACGCGAAAAATTGCTTACCCGCACTGTGGCGGTGAAAAAAAATAACTGATCTCGA
CGACGTTGAACACGTAATTCGCATTTTATCTCGAACATTTATAAGCCAAATTGAGTTTCG
AAAATTGCTTGGTTGCGTTATACATAGCATTAAAGTACGACGGAGTCTATTTTCTATTTT
AGGTTCATCCTTTTTTTTTTTTTCATTTTGCCCCTCCATCTCCATTTTTCACTCATTCTG
GTCATTTCTTCGTTCAGTTTCATTCACATTTTTGAACTGATTTCACCTTTCCTCCTTTTA
TCAACGTAATAGCATATTTTCTAACAACACAGCCATTGCC
Chr coordinates Chr XV from 720065-718653
w3c xhtml validator w3c css validator