Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NPT1
Systematic Name YOR209C
Strain S288c
Description Nicotinate phosphoribosyltransferase; acts in the salvage pathway of NAD+ biosynthesis; required for silencing at rDNA and telomeres and has a role in silencing at mating-type loci; localized to the nucleus
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NPT1 YOR209C
ATATATATTATTTTCTATTATTTTGGAAGAGAATGGTATTCCTACAGTATGCAGAGACAC
ATCTGGTTGTCGTGTAGTTCTTTTAGTGTGTGAGAATAAATGGTTATCGTTTCTATATTC
ATGACCGCTCTCATCTTTTTTTTTTCATCCATCAAGGAAAAGAAAAGTTCAAAAACAGCC
ATATTGAGGAACACTTAATCTCTTTTTTCTAATGGGTTGTATCTTAAAAACTTTTCAATA
AGATCGACGTGGGTTAGAATCATTCTTCTACAGCAGTATCTTTTTAGACCTAATCTTGAC
AATGCAGTACCTTCATCCAACTCATCTTCTTGCAACAAGTTTAAGTAGCTTTCCCACTTG
TCACCAACAACTTTACCGCATGAGAAACATCTGACTGGGACAATCATTTTGTATTATTAT
TTTGCTTATTGAGGTTTACGTTCTACACTCTACAGTTTGAATACACTTTAACTATCATCC
CATTGTGATTTTATTCAATGTTTCTTTTTTTTTTTCTTATGAAATTTTTTTTACCAAATA
CAACGAGTGAGAAATTACTTTTCGTTCAACGTGATCTTTGTGTTCTCAATTGCTGACACT
TCCAGTGTAGTAGCCATCGGAGTGCTGATAGTAGCTTATTTTGGGCTTAAAAACCTCAAG
AATATGAAAAGATTTATCAGGTCTGCTTTTGCATATATGAACCCTTCATCTTACTTTTTT
ACGTTGTAAATTCGTCAAAATATCAACAAAAATGGCTGCTGCGCCTGGGTGAAAAATTCG
TCAGATCCGTTCTTATAAGACTGGAAAAACTCGCAAATGAAAGAATTGTTGTCTTTGACT
AACCAAAATGACGAGCCTTTCAACAGTTATCGAAACGTAAATTGGATCCCATCAGTTTTT
TTGTTTCAATTCGTCACTGTAAGGAAACAAACGGTAGATAATATTTTAGAAGAAAGGTGG
ATTTAGCCTTTTGTACCTATTTTCGCCAAGCAAGATAACC
Chr coordinates Chr XV from 737726-736437
w3c xhtml validator w3c css validator