Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STE4
Systematic Name YOR212W
Alias HMD2
Strain S288c
Description G protein beta subunit, forms a dimer with Ste18p to activate the mating signaling pathway, forms a heterotrimer with Gpa1p and Ste18p to dampen signaling; may recruit Rho1p to the polarized growth site during mating; contains WD40 repeats
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>STE4 YOR212W
ACAGAAATATTTGAAATATATTTCCTCAAAGAGTACACTAGATCCATTCATATTTTAGGC
TTCCTATGGAAACCGTTTTTTCAAGGATAAACCCCGCCATATGTTCTTTGCGAAGTCTTT
TGCAGTTAAAACTAATTACAACTCTGTTATTTACTGACACCTGCGTTAAAATTTTATCAC
AATATGTCATCCGCTGAGAGAGATGTACTATTTATAATTACTTAAGAGCGACTACTTCAT
TTACCATTAGCGAGCAGAAGAACAGCTTACTTGTCGATGTTCTTCTCTGGCTAAATGAAA
TGTCAATTATTGAGATTGAGATGGGTATGTATGATCGGATTTTGATATCAGCCGATGAGA
CGAAGATTCAATAGCTTCAACCGTCCCTGCGGGGGGTACTTACCTTTTGTAACCAGTACC
CTGTGCAAATTCTCGGCGTGTACTACCTCTTTTGGGACCACAACCCTTTGTACGCACTTT
CGTCAGATGCAAATTTTTACACGCGTTGAAAAATGTTTCAGGAAGAGATACTGCGTAAAA
AAAAGACACATGTGTTACGCAGGAAAAAGTTTGTGAGGCTTTTTGCCTTAACAGATTGAC
TTGTAGCCCTGTTAGGTTTACCCAACAGTTGTTTTTCTGTGTGTCGAAAATTTTTTCAGA
TTGTTTTCAACTGACACTTGCCTGTTTCATATTAGTTGTAACTTAAACTTTCAAACATAA
AACTTTTTTGGAAGTCCATCCTTCACATGACTTGAATCCCTTCAATATCGAAACAGTATC
CTCAAAATCTCTTATCACTTTTCTAATTGTTTTCTTCCCCTTTTTGTAGTAACTCGCTGT
AAAGCACATTTTATTCATAATCTCCTTTGTGCCAGAACTCAAGGTCAATAGGCCAGAATT
ATTGGAAGGAAAGAGGGAAGAAAATACGATATTGCTAGTTCATTAAGTCAAGGAAGAAAA
TACTCAAAAAACTGTACAGCTCAATCAGGTACACATTACG
Chr coordinates Chr XV from 742910-744181
w3c xhtml validator w3c css validator