Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AIM41
Systematic Name YOR215C
Strain S288c
Description Putative protein of unknown function; the authentic protein is detected in highly purified mitochondria in high-throughput studies; null mutant displays reduced frequency of mitochondrial genome loss
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AIM41 YOR215C
ACGACATAATTGAAAAACATAGTAAGGAACTTAACACTTACAGGAAGGAAAAAGATCAAT
TAAATCTCCAAGTTCAGGAACTCATGATAATCTTAGAAAATAATAAACAAGATATATCTG
ACTTGAGAACAGAAAGAGATGAATTGAGACAGGCTTTGGAATCCCATGAAAAGGAGAAAG
CAGTATTAAAGAATTCTCTAAATGATCTGGAATTGAAGATAGAAGAAGTTGACAACAAAA
GGGAAGAAGAGGCTAGAGAGAGAGACCAGGAAGTCAAATCTTTACGATCCCAACTTGACA
CGGAGATAGAAACGCACAACAATGACACAGAAGCTTTAGAAAGCATGAAAAAACAGCTAG
AAGCCATGAAGGAGGACGCCTCTATGAAGGAAAAATATGAGGAAGAATCTAAGCAGCACA
TCTTACAGATCGGAAAACTACGTCACGAAGCCATTATACTAAATGAGCATTTAACAAAGG
CACTGGCCATGTTGAAGAAATCAAGCGATTCTGAATCCGTTGATAAAGAACTGATATCCA
ATCTATTGATATCTTTCGTGTCCATACCCAGAGCAGACCCAAGAAAGTTTGAAGTTCTTG
AATTACTGTCCAATTTCTTAAACTGGGATGAAGATAAGAAACAACAGGCCGGCTTGATCT
CGAATAATGAGTCTAAGAATTCAAGCGCTGTATCGAGAACGGAAAGCTTTGTATCGCTTT
GGACCAACTACCTCGAGAAAGAGAGTGAGAAAGACTAATCGGGCAAACTAAGTCTAGTTC
AGAAGAGCATACGTACTTAGTGTAGCATCACCCAATTTATACTCTATAAACGATAAATGA
TATAAATCACATCTACCCGGCATCTGGGACTTTTCGGGGGGAAGGACTCAAAATTAAAGG
GAAGAAAAAGGATCTGCAACATTTTTTACAGAAGTAATGAACTGGAGAAAAAAGACTTTG
GGATAAAGTTGGGGAATACAGCAAATAACACTATTCCAAG
Chr coordinates Chr XV from 747282-746725
w3c xhtml validator w3c css validator