Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STE13
Systematic Name YOR219C
Alias YCI1
Strain S288c
Description Dipeptidyl aminopeptidase, Golgi integral membrane protein that cleaves on the carboxyl side of repeating -X-Ala- sequences, required for maturation of alpha factor, transcription is induced by a-factor
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>STE13 YOR219C
TCAATCCTAGTGGCTTAGAGGCGAAAAGGCATTTGGTGCCTGACGCTGACTTATCCTTAT
TTTCTAGTTGTGAAGGTAATGATGTCTGTGAACTTCTGTTCAATGAGAGGTTCGAAGTTG
AAGAAGACGACCTAGAAAGCTTTGGTAGCGGTTCTTGGTAACTAAATGGCTTTGAATCCG
TCGAAAGCTTCAACATTGTGGGCGATTCTAGAGATGATTTATCCGGAGATAATGAAGAGC
CTCCCTTATTGAGGGATGAACTGTCTACTCCAGTGACTCCTGGATCTGTATTAATAGATA
AGAGCGGTTTGTTGCGATGATCCTCCAAAAGTGCCAAGTTATTATCTTGCAACGAAACAG
CATCATCCGTGGAACGAGATCGCGGATGTTGATTATTTAAAAGGGACTCAGTTACAAATA
ACTTCATCGGACCGCTATTCTCCTTAGCTAACAATTCCTGTAAGAACTTAAACACTTGCA
GCGTGTCATCTTCATTATCAAATATGATTATAATTCTGTTTAAAAATGGCAACGGCGTGT
AATACTGCAAGTGACTTTGTAAATTTGGAAATTGCTCCTTGAATAAAGTTTTTTCCAGTT
GTGTAGGCCATTTACTAGTAAATTTGCCACTAGGAATGTCCGTGATTAGTATTTGAGTTC
TCATTTGCTTTTGGTTTGCCATAATTCCCGATTTTCTAACGCTAATGTATCTTTTTTTGG
TTTTTGATTGCTACCATTATATGCTTTTGTAGCATCAAGGTATATAGTATAAGCCTCTCT
CCTTATTCTATCAAGGCGCGGCTTTACGCATAGCCACCCGGCCGATGAAATTTGTTTCAC
GGTATAACAAACAACTTCAAAGGTGATTGTACCTAGAGTCTTTTAAGTATGAAATGACAG
AAATTAGATACCTATTTTGTTTTGTTGTTTTCTTCCAGCCTCATGACCTCAATAAACTTA
GTTAGGGTGTTATTCGTGTAAAAAATATAGAAAGCCCCTA
Chr coordinates Chr XV from 755009-752214
w3c xhtml validator w3c css validator