Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RCN2
Systematic Name YOR220W
Alias WSP1
Strain S288c
Description Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and is induced in response to the DNA-damaging agent MMS; phosphorylated in response to alpha factor
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCN2 YOR220W
CAAGGTTTACTTCAAAAGTCTCATCAAATAACTGCTTTGCAATAAAATTCGTATGTCCAT
CAATTTCTTTTGTAGTAAAATATAGCCCCGGATCTGAGTCTTGGCCTAATAAGCGCTGTG
GTGGGTCAATAAAGTGGAAAGTATCCTCAGGGATGGCAAAATCTCCGTTCAAAACGTTTT
CAATTGAGAAAGATCTTTTGCCCAAACTAGAATCTCCTGCAGATGTCTTAGGACGCGTGA
TTTTGGTAGGTAGAAGTTTTGAAGGTATTAGAATAACAAGTAGAACTAAAACTGATAGTG
CTATTAATGTAAAGACTAAGACATAAGATCTTTTCTCGGGCAGAGACCATTCTCCCCATC
GACGATTAAATTTGTTTACACTGAAAAAGGAATGCGTGTGATGCTGGTTTTCAATATCAT
TAAACTGGAAGCTTTCTCGTCTGGGACGCATTGAGTATTGTTCCTGGAGAAAGGGGGTTT
GAGGAACATCTGTAACATCTATTGTAGCTTCTGTCGGTCTAATCTCGTTAATTGTATGTC
CATTCTCGTTACTTTGAGGATCTGTGTTAGCTACACTATCGTTATTAGGAAAGAATGGCT
TATCCATGGAAGAGTTTGAACTTTTCCTTTGCGGAAATAAATGACTATTCTTCCTTTTAT
GCGAATGAGTTGAAGCAGACATTAGGGGCTTTCTATATTTTTTACACGAATAACACCCTA
ACTAAGTTTATTGAGGTCATGAGGCTGGAAGAAAACAACAAAACAAAATAGGTATCTAAT
TTCTGTCATTTCATACTTAAAAGACTCTAGGTACAATCACCTTTGAAGTTGTTTGTTATA
CCGTGAAACAAATTTCATCGGCCGGGTGGCTATGCGTAAAGCCGCGCCTTGATAGAATAA
GGAGAGAGGCTTATACTATATACCTTGATGCTACAAAAGCATATAATGGTAGCAATCAAA
AACCAAAAAAAGATACATTAGCGTTAGAAAATCGGGAATT
Chr coordinates Chr XV from 755328-756125
w3c xhtml validator w3c css validator