Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MCP1
Systematic Name YOR228C
Strain S288c
Description Mitochondrial protein of unknown function involved in lipid homeostasis; integral membrane protein that localizes to the mitochondrial outer membrane; involved in mitochondrial morphology; interacts genetically with MDM10, and other members of the ERMES complex; contains five predicted transmembrane domains
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MCP1 YOR228C
CTCAACATCTTGGAAAGCATCACCATACTCTGGATTTGGGGTGGCTGCAGACTTCGTCTT
GCCGTTACCTTCTTCGTCGTCGTCGTCGTTGTCGTCGTCGTCGTCGTCGTCATAGAATGT
CTTTAATGGTAAAGTAGTGTCTATTTCGTAAATATCACTACCTTGAGAATATAAAAGACT
AGTCGTCAAGGTGCCCTTGGATTTGTCTGGAATAATCTCACTTCTCCATGTCAGTGTCTT
GCTAAAATGTAAAACATCGTCGACTCTTGTGCTGAATTGTGGTTTAAAGCTAGAAATGTG
TTGGTATAAAGAAGGTGCCGGTTTACGGCGTGCTCCACTCGCACCCTGACTGGATTTGCT
TTTCGCCATCCTCTATCCTTTTTAGTTCTTGCTCCCGTCGCTACTAATTGCTCCTTGTCT
TATAAGTAAATGTAGCTGTACAGCAGAGATGTTCCATACGTCAGCTAACTAATTGCCTTT
AATCTTTTTTTTTTTTATTTTTTTTTTTTTTCAAAAACAATAGAATTGAAGATGTGAGAT
GGAAAGGGAAATCAAAGTGCCATAAATGGTAAAGGCTTGCATTATGACCCGAATGGGTAA
GAATGATCCAATGAGAGTCTGCGGACGCATATGTGCGGAATATGACTTAGCAGTTCGAAC
CCCGAACGGGGCTAAAAAACCAAAAGGACAAACCTTATGCGGAACATCTACCATCTATTC
AAGGGAGTATAGCTTCCGTGTAGACTATAGAAGAAGCGTTCCAGTCAATTCTACTACATC
AGTCTTCCGACATCGCTGATTGTATCCTAACCAGGTCCACAACTAAAATTTGTTTTGAAA
AGAGTGGCTAGAGAGCGAATACGTGCTCTGTAATTGTGTGAGGCAAGTTGGTCGTCAATT
GGAAAATAAGTAAGGAAAACCTTGTGTAGATTGTATTGCTCCTAACAGGTCCCGAATTAC
TAGGGCATATACCAGTTAGCCCAGAGTTTTGTTTATTACG
Chr coordinates Chr XV from 767777-766869
w3c xhtml validator w3c css validator