Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name WTM1
Systematic Name YOR230W
Strain S288c
Description Transcriptional modulator involved in regulation of meiosis, silencing, and expression of RNR genes; required for nuclear localization of the ribonucleotide reductase small subunit Rnr2p and Rnr4p; contains WD repeats
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>WTM1 YOR230W
TTACGACGATTAAAAAAAAAAAAGAGTAAGAAATTAACGTTACCACCTATGGGAAAGGCA
GTAACTCACAAGCATTCACGTACATAATTCTGTTTTTTTTTTTTTTATTCATTTCTAGCA
CGCTATCGGGGTTATTTTTTTTTTTGTAATATATAGTGATGGTATAATGTTGTATAGATA
CTGGTATCGCTCCTAATAAAGACTCTTTCAGATTTCTGAAGCCAACGAAGTAAGGCCTCA
AGAAAAGAGGGTTACCAGTAATTAACCAAGCAATTTCTTTTTTTTCTTTCCAGCAAAGAA
ATAAGACAAAAACCGGCTATATGGAGAAGAGGGAGGATCTAATGGTGACATAGTCCATTT
CAAGATTCCCTCTTTCGTTTCTCGGATGAAGCTCGATGTTTACAATTCAGAATCTTAAAA
GGCTGTCGCTAAGAAAGACCCAGAGGCACATGCAAGATAGTTGTGCCTGTACCACGTGAG
AAGGCGGTATTCAATATGCGGTGCTGTGCTGGCTTCCCTTTTTGGAACGCGCCGGGGTAT
AACAAAGAAAGGCTAAGTCATACAATAGGCAAAAGACCTTTGTCTTTCCTTTTTTTCCTC
TTTCCTAACATACGGTGGTTTATGTACTATCCCTTATGTAATTGCTTAGCTATACACAGT
GAGCACACATAGTGGCGCTCACTACTCCCTTTTAATTTCAACTCGTAGATAGTTGGGCTA
TTTTCCTTCGAATCCTCGTTTATCATCTCATATTTAAGAGTACCATTTCGGGGCTTTTTT
TTACCTTTTCCTTTTCCATGCAGTCTGTCCCCTTAATGTTCTATGTTTTTTTTTTTTTTT
TTTCAGTTCTGTAGCTTCCAGTATAAAGGGAGGGAAAAAAGAAGATCCGAAAAGTTTATA
TTCGCCTGAATTGTAGATATTAGATAAGAAAATTAATTATTAATCAACCAATCTTGAAAG
ATACAAATAAATTGTAACACACTATACATTACAACCAAAA
Chr coordinates Chr XV from 770800-772113
w3c xhtml validator w3c css validator