Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HES1
Systematic Name YOR237W
Alias OSH5
Strain S288c
Description Protein implicated in the regulation of ergosterol biosynthesis; one of a seven member gene family with a common essential function and non-essential unique functions; similar to human oxysterol binding protein (OSBP)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HES1 YOR237W
GGTTGCCCAGTGAAATGAAGTATTTCAGACAGGTCACTTCATTGACGAAAGATCCAAACA
AAAAAAATGCTTTGATAATGGGAAGGAAGACATGGGAATCCATACCGCCCAAGTTTCGCC
CACTGCCCAATAGAATGAATGTCATTATATCGAGAAGCTTCAAGGACGATTTTGTCCACG
ATAAAGAGAGATCAATAGTCCAAAGTAATTCATTGGCAAACGCAATAATGAACCTAGAAA
GCAATTTTAAGGAGCATCTGGAAAGAATCTACGTGATTGGGGGTGGCGAAGTTTATAGTC
AAATCTTCTCCATTACAGATCATTGGCTCATCACGAAAATAAATCCATTAGATAAAAACG
CAACTCCTGCAATGGACACTTTCCTTGATGCGAAGAAATTGGAAGAAGTATTTAGCGAGC
AAGATCCGGCCCAGCTGAAAGAATTTCTTCCCCCTAAAGTAGAGTTGCCCGAAACAGACT
GTGATCAACGCTACTCGCTGGAAGAAAAAGGTTATTGCTTCGAATTCACTCTATACAATC
GTAAATGAAACCTCTCCGCCCGTATATTTTTTTTAATATGTTAAATAGTGATAGAACTGA
TAAGCCTCATTTTCTTTTATTGGGCTCCAAGACGCGAACTGTTCGTAGGGTAACCGTTTG
ACACCTAAACGACCTTTCAGCCTCACCTGCAGTATTTCTTCAACAACGCCTGTCGCTATG
TTAAATAATAGCAATCGTTTGTGATCACCATTGTCGAATTTGACGCGCTTAAACAAAAAC
CATTGTTTTGGCCTCGTTCCCTGCATTCAACAAAAGAGCAAGGTATGCCGTCAAACAGTC
GTTAAAAGAGAAGGTTTATAAACTATCTTGTTTTGTACTTTGCTGTCCCGGATCCAGTTG
GGTCTTCTTTTCAACCTGTCTGAGTCCGATCTTTCTTTCCCTACTTGAAGCTCCATATAT
CTAAGTCATCTAAGTGTATCCTGCTAGATTACAAACGAAA
Chr coordinates Chr XV from 781994-783298
w3c xhtml validator w3c css validator