Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OSW1
Systematic Name YOR255W
Strain S288c
Description Protein involved in sporulation; required for the construction of the outer spore wall layers; required for proper localization of Spo14p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OSW1 YOR255W
CTTAGTATACGATTGTGTTCTTGCCCACCATCTACTAACAAAATATGGCAAGATTAAACC
TAGTAGCGCAACATAACAAACCACTAATAATGGAGATGCACTTCCATCTACCAAAAATCT
TGGTAGAGCGATACCATGTGAAGTAGATTGTGGGCCATCTGGATGACCGTATTTCAAATA
GTTTTGCCTAACCAATTCGTCAGTAAGGGATTCGTAAGCCTTCGTAATCTGAACATAAGT
TTCTTCCATCACACTTTTCTCATCAGGTGTTAGGCCCTTTGCTAATTTATCTGGATGAAA
TTTAACAGATAATTTTCTATAAGCAGATTTGATGTCTCTATCGGAAGCACTAGTAGAGAT
ACCAAGGATTTCATAAGGATCAAATAATTTTGTAGCAGCGTCTTTAATCGCGTCATTACT
ATTAATCCTTTGCAGAAGAATTGCAACTAAGATCCAACCCACAATAATTATAATATTTCT
CCTGCTCCATATTTTGGACTTCTTATTACTATTTTTATCAAACTTCCTTCTAAATTGTTT
GATTTCATCACTGGTGTATTCTTCATTCAAGTTCTTGAAAACTTCCTCATTAAACTCCTT
ACTCTTCCCTGAATTCCCATCTTCAGCATTGGCCCCAAAAAAAATTTGGTATATTTGAAG
CAGTGTCATAGGCCCGACGACCATCAAGAGCCCCGTTAAAATGAAGGACGGCCACGTCTC
ACTAGCCTCATCATACTCGTAATTTGTAGGCATTGTGCTGTAATATGCAGTATATTTATT
TTGTTGCGAAGGCCTTCTTTGGTCAATTATAACTGACTATTGTTCCAGTCGCATCTTTTA
TTCGTTCAGTGATCTTCGACGTGTTCAAGACAAATTTTTCAGAAAACGCCTTTCCGTAAC
GAGTGACCAATTCGCGTTATAAGAGCGATTGTGTCAGTAATGAAGTCAGATTGTGACATT
ATAAAGCTAAGACGTTAATAACTCAAAATAGAAAAGAAGC
Chr coordinates Chr XV from 807271-808107
w3c xhtml validator w3c css validator