Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HRK1
Systematic Name YOR267C
Strain S288c
Description Protein kinase; implicated in activation of the plasma membrane H(+)-ATPase Pma1p in response to glucose metabolism; plays a role in ion homeostasis; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HRK1 YOR267C
AAAGGCAAGCTACAAAATGTACTACGCGGAGCCAGAATTAAAAACCACGCGGACGGGACG
GGCCGTGGCTTGTGACGCCGGATCCCCGCGTATAATCCGTGTCACGCTAAAGGACAAAAT
CGGTTTATCCGAGCGGTTTACGGGAAGGGTCTTTTGCTATCTCGCAGTAGCGTGTGCCTG
GTTATCCCAATACTACCACCACACCTGTGCTTTTTTTATCTTGTACGTGCATGTATGCGT
ATGTTTTCTTTTTTTCCGTTGGTGCTTATTCGCTACCGTCTCGTTGATCCATGAATCACA
AACACAAGCCGGTTCTGCTTACTATACAAAATAGTCTTGTGTCTTGATTCATATATCCGT
CAATAACGTAGCCTTTCTTTATTTTCCTTTCGCTCACCATACTCTTGCATTAGTGTATTT
TGTCTTTTATATCGCCAATAAGTGCCCAACTCTTCTACCTGACCCCTACGTCGTCGCCGC
CCCTTTTCTTTTTCTTCGCCTAGTTCTATTTGGCTATATATTTCAGAGTGACAAATCTTT
AAGAGAGACAAACTGAGAATTAGCATATAGAATCATTCATACAACTGTTTACAAACAAGT
AAGCCCAAGACAGTTCCCAACCGCTTAAAGAAGTTTTTCCTAGAGGGAGCAAAGTTCGTT
TACATTTCACACACACAGTTTTTTTTCACTTTTTTGGGCCTCTTCCTTTTCCCGTTTTTT
TCAAAAAGCTTAGAAATCTTCTTCACCTCCTATTTTTCTAGAATCGTGAAGAATTTCCAG
ATTTAACAGTTTTCCACTTTTTCAATAAGGAAATAGTAGGAATAATAAAAAAAGGATAGT
AGTAACGATATACGTCGACTTTCCAGACTGGTCTCGAGCCGGAATTAAATACAATAGCAG
CGTTTGACTACCACATTGTAGCTCCGCTAGAATTGATCGAAAACAAAAATAATAACACTA
ATAATTATAATAATACGGTAGAACTATTTCTCGTATAAAG
Chr coordinates Chr XV from 824867-822588
w3c xhtml validator w3c css validator