Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPO4
Systematic Name YOR273C
Strain S288c
Description Polyamine transporter of the major facilitator superfamily; member of the 12-spanner drug:H(+) antiporter DHA1 family; recognizes spermine, putrescine, and spermidine; localizes to the plasma membrane
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPO4 YOR273C
CGAGCAAAATTCGCTCTTTATCTTTCGAAGGCATGACCACAATAGCGCAAGTAGATATGT
AAATAAATCTTCCTAAACCGGTCTCGGAATGCAAAGAGCTTCGTATTTCAAAATTACCCG
AATCCTATACATGTCAGGAATCAGGTTATACTCCCTAGCTCTTTTCCTGTTTGTCCATCT
TTTTCCTATCATAGATGGTTATGGAGGCGGCTGTTTCTGTAAGAACTACGGAGTCGCGGC
CCGGAATGGGAGAAATGCGAAGAAGCAGGCCGCAAGTGGAAGAAATTATTGGGGTAAAAG
ATCAACTAATGAACTCTGGATATAAAAAGTACAGTTAGCGTTTCTTCCCAACTTTCTTAT
GCTGCTATCAGCAAATGCATTTGCATAGGCTACAAGCCACAAGCCACAAGCCAATAAGGC
ATATGAATAATAAGAGAAAAAGTGCCTAATTGCTGTTTATATCAACCGTATGGCGTGCTT
TAGCTGCAATAAACTTGTTTTCGCCGATTACCACTAATGGCCGACTTCCACGGATCCCAA
AAATAGTGCCACGTCGGTACGGTCGGGCATAGTGGTTATTATTTCCGGGTTGTGACCCGC
TTCGGATAATTGATCTATCCCCGAGGTAATAGGCCCGTGCGGTTCCGTCTTCATGAAGCT
GCAGGGGCTCCGCTTAAAAGCCCCTGACGGCTCACCTTAAATCCGTGTTACGACACTATG
CCAAATGAAGGAAACACTGAAATGATTGCATACCCGCACTCGTGCTTACATGCTAATTGT
CCTTGTCAGAGCAAACGGTACCGGAGGCTTGAATGTGTTTATGTGTATATATATATTCGC
CTGTATGGAAAGTTATAGGTTGTCAATTTGTTGTACCTGACACATCGATTTTCTAGTCAT
CACTTTCCTGAAAATTACAGAATAAAGATACCATCTTATACACACACATACACACACAAA
GAAGCATAGACATCGTATACATATATTTTAAGTTTTACTA
Chr coordinates Chr XV from 836431-834452
w3c xhtml validator w3c css validator