Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MUM3
Systematic Name YOR298W
Strain S288c
Description Protein of unknown function involved in the organization of the outer spore wall layers; has similarity to the tafazzins superfamily of acyltransferases
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MUM3 YOR298W
TATATATCTGGATTTCGAGAAGAAGGATATATTTTATTGCTTATTTGTCTTTTTATAAAA
TCTCTCCTAAGTTAAGTTCATGGGGAATCTGACTCTAAAAATGAAATCTTAGAAATGCAA
AAAAAAAGAAAAAGTATGGGTGAGTCAGTTTCTTCCAAATATATACAAATGGTCATCATT
TTCATTCCAAAGTTTCTTTACCAGGTCAACAAAACCATTATTTTTCGTTTCCAATTCGTA
GATACCGTACAGGGACAACATGGATCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCA
TCTTGGATACTTTTCCTTCGGTATATAGTCAATAATACAACTTGTGAAGCCATACTGTAA
ATATATCAAAAAAATGGACGATAAAGACGCATCGAGTAAAGGATTTATAACCCCGCCGGT
AAAGGAGGCATAAAAAGGTACCATTGTTAATGGAATCAAAGTATATTTTGCTATTCTCTC
ATAGTCTTTTTGATAAGAGTCCTTAAATTGAGAGAACTCTGGGGGCTTAAACATCTGCAC
TGAAGAGGATGCCTCTTTTGACGTATTTGCAATATCGTTTATTTTATTTTCAGCATTTAA
ACGATTAATGCTATAAAAGGATCTTTTGGTTGAAAGTACTAATCCTGGAAAAACAGCTCG
TACAGGATTTACAATGACAGTGGAAGCATTAAGAACAGGCTTCAAGCCAGGAAACAATAG
CATTACCAAAGGTATTAAATTACTCAGTTGTTGCACCTCGCATCACCGTTAATTAATGTG
TGCATTCCACTGTCTGGAAGTTTTCATTTTTATCCGATCTTTTGCGAGAATGGTTTGTTT
TTCAAAAAAACCGAGTGTCAACAAGGCATGTAGCGACACAAAATGAAAAATTGAAAGTTA
ACAGGGCAAGATATGCACCATAATAGATTCATTGTTAATCTTAATCAAATAAAATTTCTC
TTTTCCACACAGAAAACTAAACGAAAGGTATAACTTTAAG
Chr coordinates Chr XV from 875599-877038
w3c xhtml validator w3c css validator