Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RAX1
Systematic Name YOR301W
Strain S288c
Description Protein involved in bud site selection during bipolar budding; localization requires Rax2p; has similarity to members of the insulin-related peptide superfamily
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RAX1 YOR301W
CAGATCACCGGCTGGGAAAATCTGTTAAAGTACAGATCAAACATTTTCGTTATGGAAGAA
GAGTACCAAAAATCATCATCTTCGTTACCAAAGGACGTTAACAAACAAGAAGAACAGCCT
CTGAGGGCTAAACGGCTGTGTGAACGATGGTTAGACAACCTCTTCATGCTTTTATATGAA
GACCTGAAGATGTATACATTATGGCAAACCGAACAACTGTACATGGATGCACAGAATAAC
AACCACAATAAGTTGACTTTCGAATGGGAGTTATTTGGCCTTTGTGCACGTCGACTGGGC
CATTTCCCTGAGGCCGCCAAGGCCTTCCAGAACGGTTTATCGCAGAGATTTTCATCAAGG
TGCGCGAGGAAACTGCTGGAATATTGTATAAACGAACGCCAACGGGTCAAAAATTTTATA
AACTCACCTAATTCGCATGACATGGTCCCTGAAATAGTAAGCTCACGCATAAGAGAGCTA
GACAATAGCATTATCGACCTTTGCGTGAAGATATGCTGCTGGAACCACCGTTGGTATACG
GAATTTTCCATAAGTTTACTTGATTGTTTAAGTGTGGTTATTCAAGATATGAGTCTGACC
AAAGTTTCGAATGAAATCTCGTCAAGATATCCAGAAACTGTTCTCAACTTGGTGCAGGAG
AATTTGCTCAATTTCTTCACTACTTGCACCATTGGATGCTACGATGCATAAATACGATAA
AAAGACATTAATACGTATATATAATCCAAAAAAAATTGGCGATACGCTTCAACGTTGTGT
CAAACTCTTGGGTCACTTTAAAGAAAACCCAGCATACATTAATACAGAGCAATGCTGGTT
ATGTAACTTCGCCGCCCGCCGCCATTCGAGGAAAAATATTCGTGTTTCGAGAATGCGGGC
AAAACGAAAATATCAATAAAACACATACGGGAAATTCATTGTGCACAACGACCTCTAACA
ATTTCTGCCAAAAAGAAAGTTCAAGAGCGTCCCATTCATC
Chr coordinates Chr XV from 880965-882272
w3c xhtml validator w3c css validator