Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CPA1
Systematic Name YOR303W
Strain S288c
Description Small subunit of carbamoyl phosphate synthetase; carbamoyl phosphate synthetase catalyzes a step in the synthesis of citrulline, an arginine precursor; translationally regulated by an attenuator peptide encoded by YOR302W within the CPA1 mRNA 5'-leader
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CPA1 YOR303W
GATATGTTCTAATCTTCCTGGCGTATAGTCGCGCAATCCGTGTCGTTACGGTCGTGCCAT
TTACACTGGGATGCTACTGCATTGTGTGTGGCATGTATCAAGTGGACATTGTGTATTCCT
GGTTTGGCGTCACACAGAGACTTCTCCACAGACACAAAAACGCTGGCAATGACGAAGGAG
ATGCTTCTAGTGATACCGATCACGTGCCAATGATACTTGCGGTGTTCGGCGGTAGGCGCC
GTCTTACCCGCATAGAGCACCCATTTACTCGGCAGCTTCTACGTAAGCGTGGACTGTGGT
GTCTGCTTCTCGTAGTGGGTGCCACTGCCGCATTCACAGTTATTTTCAGCTGTGTTCCCG
GCCGTCGTGTATGATGTAATCCATCACCCCCCTATAAAAACACCTGTGCACCGCATATTT
CCATAGCGCGTGACGCTAAGTACAAGAAACAGCGAGGGGCCGTTAAGTGCAGGCTTTACC
GAGGGCGCCGGCTGGCGCTTCCCGTGGAAGGGTGTTTGACTCATCATCGCATCGCATTAC
CTCATGATGAGTAAATAGTTGCGATTTCACTTATCACCTCTCGCGGAAAAAAAAGGCGAT
GACATGATATATAAGGCTCTCTCGTAAGACACTTAACTATCCAACGTTCATTAGATTATT
CGGTCAATTTCTTTTTTCATGCCCCTCCTTTTTCTTTTCTTTTCTTGACTCGTCGTTTCT
TTTTCTTTTTTTTTTTTTTTTTTTTCTTCAGAACTATAACACATAGATACACTCGAACAT
CTAATTGTTTAAATACTGCAAAGAATACAAGGTAATCGACTCTTCTACATACCCTTTTTG
CAGATTTGAAATAAAAAAAACATTATATGTTTAGCTTATCGAACTCTCAATACACCTGCC
AAGACTACATATCTGACCACATCTGGAAAACTAGCTCCCACTAATTTCATTGCTTAATAA
TCAGAAATTCTATCACAAACCACTCCTAAAAATATTTCAA
Chr coordinates Chr XV from 882899-884134
w3c xhtml validator w3c css validator