Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MCH5
Systematic Name YOR306C
Strain S288c
Description Plasma membrane riboflavin transporter; facilitates the uptake of vitamin B2; required for FAD-dependent processes; sequence similarity to mammalian monocarboxylate permeases, however mutants are not deficient in monocarboxylate transport
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MCH5 YOR306C
GAAAACAATGGCTACAATCCCTTGATTATCTCACATGCGATTACAAAGCAAAAGAGAAGA
TTCGCATGCAGGAGCCATACACGCGTCTTTTTTAAGGTATTTCCACGATCTCGCGGAAAA
ACTTATAGAACGAACAACTATTGCTTTAACTAGGAAAGAATAAGAAAAAATAGCGATCAT
ACTAGAACCCACAGTCGAGGCACAAGGATTTTGAGGATTGCTCTACCCCTAATGCCTATT
GCTTCGATTGCTGAAAGCGGATCTACTCCTTTTTCCAAGTACTCGAAAGGTTGAGAGAAA
TAAAAATAGACTAGTCGACGGACAATGCCAATAAAGTTTGGTTATACGAACTGCTTTAAC
CAAATTAATATTGGACAGACTCCGTGTTTTTTGGTTTTGCCCTTTTTTCCCGCTAGAACG
ACATTGTGTTTCTCCAAAATTATTCCATCTTTTCCCTCGTGTTAACAATAGAGTCACAAC
GCACCTGTTATTATGATCTCGGGGGTGGCTTCCCGAACATCGTCGGTTGAATACTGCGCT
TTGGCGTCCGAAAAAGAAAAGATAGGAAAGGATCGAATTTTTGACATTTTTCTCAACCTG
CTGCGCGCTGTTCTATAGACGTTTGAGGCACCTGAAAAAGAAATACAGCGGAATAATTAC
TGTTCTGCTGAATCGCCCTAGGCGGTATTGTATGAGGCTAATAATAGAGAGACATCTCTG
AAAAGAAACTAGAGGAAAATTTTTCAAAAATATCTATTTTGCTCAGAGAAATGAATATAA
TAAAGAAGCTATTTGGTTAGATCTCCCAGTAGTTACGGGGACTAGATATATAAACTGCTT
GATGTACGTTTGGAAATTCTCAAATAGCAATTCTCTCTTCAAAGTTAGTGAAGGATAGGT
TATATCTGTAAAAACATACTAAGATCTGAATAACTAAGATCACGGGGGCATACTATCGAT
TAAAAAGCTCTGATTTTACTATAGATTAAAAAGAAAAATA
Chr coordinates Chr XV from 891432-889867
w3c xhtml validator w3c css validator