Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL20B
Systematic Name YOR312C
Alias eL20, L18B, L20B, L20e, RPL18A1
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl20Ap and has similarity to rat L18a ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL20B YOR312C
CAAAGGTAAGAAAGTTCCAAATGATTCCTTTTCTTGTGAGTTTAATAGGGGGCTAGCTTT
AGAATACAATTTTATGACAAGAGCAGTTTCTGCAGTTAGTCATCAAGTTGTTGGTATTGC
AAAGCTTCCCATTGCCTATGGATATCATACAAACTCTGTTTATAATAAAAACTTAGACAA
ACAGGCCGATTTAAAAATGAAAAATGTATTGAGAGGTACTTGGGATACCATAACTGATTT
AGAACGCGAAATTTGGGCCTCTGTCACCGATAGAAGTTTGTTTAGATTTTTTGGCAACAA
ATCTGAGGGAGGAGATTTACCACATCTAGTACAATAAGTTCGCATAGAAAATAATTTTAA
TATAGGCGAGAATTTCAATTTGTACCTACTGGCGCAAATTCAATAGGTGTTATCTATTGA
AAGCACTGAACTTAAATTTACCAATGTATACACGCTCAACATAAAAAAGAGGTAAAAGAA
AATATATTTTTTTGTAAGGAAAGGCTTAATAAATATTTACAAGCTAGATAAAAAAAAAAT
CAAATAGCAAGCTATTCTGTCATATCTTAAGGTGCTGATTGTTTGTAGGCACGAAGTAAA
CAAGCTCTTCCCCAAAACAATAAATACGGTTTTCGGGACTGTTCACCCGTACATTTTACG
TTTCCGACGGCGCGATGCTATCTTTGAATTTTTATCTCTTTCAGGTAACCCCATGACCAG
TAGGGCGGCTTACTACCGAAGAGAAAAATGTCCGCGGCCTAGACAGTTACTTCCCAGGCC
AGGGCCAGGCCACACGGACAGAGGCAGATTCCAAGTTGTTCCGCATAGTCTGTCTAGCTC
TTTCTCAATTTTCCGCCAGATTCTGTCTAATTTCTTTCCGCTCGAGTTGGCAACAGTACG
AAGAAGTAACTCTAATAGATAGATATAACCGTTTTTGAGGGCATTATTTTTGCAGAAGAT
AATAGAAGAGAACCGTAACAAAGGAATCAAGCAAAGAAAA
Chr coordinates Chr XV from 900767-900250,901194-901194
w3c xhtml validator w3c css validator