Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FAA1
Systematic Name YOR317W
Strain S288c
Description Long chain fatty acyl-CoA synthetase; activates fatty acids with a preference for C12:0-C16:0 chain lengths; role in the competitive import of long-chain fatty acids and sphingoid long-chain bases; accounts for most acyl-CoA synthetase activity; localizes to lipid particles and the plasma membrane; role in sphingolipid-to-glycerolipid metabolism; forms ER foci upon replication stress; faa1 faa4 double null complemented by any of human ACSBG1, ACSL1, 3, 4, 5, 6, SLC27A2, or 4
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FAA1 YOR317W
ATTTATTTTTTTTTCTAGGAATAAAAATGAAGAACGGGAAGAAAAGGAAAAATGAAAATG
AAGAATATGAAGAGTAAACCTACTTAAAAAAAAAAACCATACTTTAGTATTTAATGTAGC
TACCACGCGTATTCGATACACTATTATTTTTCTTGACTTAGTATGTCAATTGTAGGTAGC
CTCATGATGCCCTCTTGATCTAAGCGCGGTGAAAGTCCGCAGGCAATTGCTATAATACTG
ACAAAATTTATAAGGGGAGAGGGTCTTTTTTCGGTCCGCACGGAGCGGGCGAAGAAAACG
TAGCGGTGAGAAAAGAATACGTCACCAAAGTATCAGAAACGTCACTGCGTTGTAGATGTA
AGACCGATCCACTTTGCCAGCTGCTTACGCTGCGGAAAGTAAACAGACCTAGCTAGCGGA
CCGATAGAGCCGGCTGAACTTTATAACAAATGCGCCTTCTAACAAGCGATGAAGCCATGC
TTAGCGCGGCAAAGAGAATTACTTAGAATATGGATGATGCAGCCCTGTCATATTCTTCCA
TAAGGGAATGACAAGGACAATAGTAAAGTCGATCACGCCCTGTCAGGAACATGATCTCCG
CCATGTGAATATTTATGCATGATACAGGCACGAATACATCATATAATACGAATGACACAG
GGGCACCCACCCATCGCATATCAGGAGAACTTCCCTGTGCATACGGGACAGCAGAGATAG
GCTGTTCTCGCGCGTTTTTTTTTTTTTTTTGCTTTTTTTGGTTCCTTTCGCGGATATCGT
ATTATCGATATTACAACAAAAATGTTTGGAGATCTCCTTCGCTGTCTTTAAGTAAAAGGC
TTTAACCGCTTATTTTTCTCTCTTTTTTTCCTTTTACCCCTCACTTGTCGTGAGACAATT
GTAGTATATTTAGTAAGTATAGAAAGTTCTTGTTGTTAAAAAACTCGTTAGGATACAATA
AAAACTAGAACAAACACAAAAGACAAAAAAAGACAACAAT
Chr coordinates Chr XV from 909343-911445
w3c xhtml validator w3c css validator