Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YOR318C
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; transcript is predicted to be spliced but there is no evidence that it is spliced in vivo
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOR318C	6324894 upstream sequence, from -1000 to -1, size 1000
TTCTTTATTCAACAGCCTGTCAACGTCATCACCGTATTTTGCGTTACCTTTTCCATTTTC
TTTGAAGGCATAATCAACAGTAATTCTGTTGTTGGCGACTAACTGATTGTTCAAAGATTT
TATTGCCAAATCTGCTTTTTCAAAGTCCTCAAAATAAACATAAGCACACTTTAATTTTCC
GTTTGATAGGTAGAAAATTTCGGGTTCCCTTATGAGCTTACCAAATTTATTGAAAATTTT
CACTAATTGGTCGCTATCTATCGAATCTGCAAGGTTTTTTATGAACAACTTAGCAATAGG
TAGAATCATGTCCTTAGAAATATTTGAAGGTAAATTAGTTGTTCCTGTAGAATTGGTTAC
TTGACGAACCTTTATCAGTCGGTCGTATAATCTAACGGTATTATTCATTATTTTTATTGC
ATATTGAGCATCTCCTTGATTATAAAATTCGATGAATGCGTAGCCTTGGTAAGCTTGTAG
AACTTTATCTTTCGGATACTTAATCCTTAAAACAGGGTTGATCTGAATGAAGAGTTCATA
AAGTTGTTCTTTCGTTATCCTTGGATCTATATTCCCCACATAAACTGTATTACCAGAGTC
TGCGCTGTAGTTCATCAATGTTAATCTTAGAATGATTGCGCTGTTCTTGGCTAGCTATTT
TGCCCATTCATTTTTACCTCATCTCGGTAATTTCTGCTTGAAGAGTCGTTTTAGCTTTAC
TATCCATTTCCGTCTTATATCCACATCTGCGGGTAACAAATAAATAAATAAGGCCATCTG
ACAATTCAAGGCAGGGTAACGAGTGGGATTTTGTTCTCTTTGTTAAATCTGGATTAGAAA
AATAAACGCCGAATAAATCTTCTGGAAATGTGAAAATTTCAACAACGCCAAGAATAAATC
CCCTCGTTTTGAAAGAAAAGCCAGTAAATAGAAGTGGGAAAACGGCGTTAATGAGGAATT
TGTTGGATTTTCAACTAAAAGAAATACTCATTTCATCAGC
Chr coordinates
w3c xhtml validator w3c css validator