Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FRT1
Systematic Name YOR324C
Alias HPH1
Strain S288c
Description Tail-anchored ER membrane protein of unknown function; substrate of the phosphatase calcineurin; interacts with homolog Frt2p; promotes cell growth in stress conditions, possibly via a role in posttranslational translocation; FRT1 has a paralog, FRT2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FRT1 YOR324C
AGAACAATACCCGAGTATGTGTAGATATTCAATTGAGAATAGCGCTGTTTGATGGCATGT
AAAACAGCTGGCTCATTCAAGTAAGATAAAGAGGTCAAATCTTCCGTTGCTTCCAAAATG
GGAGGGTTTCTAAGAAGCGGTAGAGATTGGTCCTTATCGTTATTCAAGTCTTTTGTGTCC
ACGGACACGATTTCATCGTCTTCCAATTGTAACTCCAGGTGGTACTTGCCGTCGTTGAAC
TCATTTTTGATTACTTCCGCCCCAATCCAGCCCAATTCTTTATGGGGATACCAGCATCGT
GTACCCACTTCAAAAGACATTATACGCTGTAATATCTGCTGTTTTTATGTCCTATATGTA
CAATGGTATAAGTATCGCTGTCCAATGGAATGGTGTCGAATAGTACCTTAGAAAACAAAA
AACAAGCAAGCAGCCAGAAATCGAACGAATAATTTCAAGCGAGAAAAGTGAAATGACTTT
GCGAGACTTTTTTGTTCTCTGATTGGCCTTGCAAAGTTGATAGATCTCTGAAACGCAGGC
TACGAATCGTATCAAATGAAGGCGTGTTTGGGATTTCTGATATTTGGCTTTTCGAGAAGC
GCGATCATAAACAAAAAAAAGGAAAAAATCACAAAATAGCCCTGGGTCGGGTAATAGTTT
TTGCCCTACGTTTTCGTAAATGTGTCACTAGGTGCAATTGCCAATAATTAATTGTAACCT
ACTCAATATCTATTTTAGCCCTACATACGTTAGGGTCGAAAATCTGTTGGGGTTTTGGTT
TTAACAGCGTAAACTAAACCAGATAAGCATCGAGAAACGGCGCTTGGCACATCGTATATC
AACAAGACAAACCAGTGACCGGAGTTCTGAGGCGTCTTCGAGCCTATTTATTTATTGATC
TGGGTCGGATAGTTCACCCTATTTGTGGAGGAAAAGACCTTCCCATATCTAAATTTTTTT
TTTTTTTTGGTTTAAGTTATAGTTGATACATTAAGTGAAA
Chr coordinates Chr XV from 925040-923232
w3c xhtml validator w3c css validator