Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SCD5
Systematic Name YOR329C
Alias FTB1, SCD7
Strain S288c
Description Protein required for normal actin organization and endocytosis; targeting subunit for protein phosphatase type 1; undergoes Crm1p-dependent nuclear-cytoplasmic shuttling; multicopy suppressor of clathrin deficiency
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SCD5 YOR329C
ACTCCAGAGTTCTTAAAATATTTTCTTGCGATGCAAGTCCAGTCAGATAAGCGCGATGTG
AATCGGCTAGAAGATGAGTATCTGCGGGAGTGTACATCCAAAGAATACGCTAGAGATGGG
AACACTGCAGAGTACAGCCTCCTAGACTATATAAAGGATGTCGAGAAGGGCAAAAGGACT
AAAGTACGTATTATGGGATCCAATTTTTTAGATGGTACCAAAAATGCCAAAGCTGATCAA
CGAATCAGATTACCTGTCAATATGCCAGATTATCCCACACTTCATAAAATTGCTAACGAT
TCAGCAATCCCAGAAAAGCAATTGCTGGAGAACAGGAGAAAGAAGGAAAACAGGATAGAT
GACGAAAATAAGAAAAAATTAACCAGAAAAAAGAATACCACGCCTATGGAAAGGAAGTAC
AAAAGAGTGTATGGTGGCAGGAAGGCATTTGAAGCGTTCTATGAATGTGCAAATAAACCG
TTAGACTATACTTTGGAGACAGAAAAACAATTCTTTAATATTCCTATAGATGGAGTGATT
GACGACGTTCTGAACGACAAATCTAATTATAAAAAGAAACCATCACAAGCAAGAACGGCA
TCATCATCGCCAATAAGAAAGACTGCGAAAGCAGTACATTCCAAAAAATTGCCGGCAAGG
AAGTCAAGCACTACAAATAGAAATTTGGTTGAGCTGGAAAGGGACATTACTATTTCTAGA
GAGTACTAGGCAAAATCTGCATTAGCTTTCGCATTTGTATTTATATATACAGCACATTAT
AATATTATTTTTTTATTTATTTCTACTTACTTTTTTTCGCCAAATGAGAAAACAAAAGTA
AGTTGCCCCTATTAGAAAAAGAGTTAACATTAGGAAACGGGGACAAAACAAAAGGTAGAA
TTCAAAATAGGAATTCAAAACCCAAATTATCTGCATCTTCTCGTTAGCTAAGATTTTATA
GATCATTGCAGGCTCGATAAATTTTACATGGTAACGAAAC
Chr coordinates Chr XV from 939349-936731
w3c xhtml validator w3c css validator