Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPA190
Systematic Name YOR341W
Alias A190, RRN1
Strain S288c
Description RNA polymerase I largest subunit A190
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPA190 YOR341W
AGTGCTGCTTCATGACACCTTGCAAGGGATTTTCTAAATACATTGGTGCCAAAGAAACAT
AGAGAGCAATGGGAACACGCACTATACAGTTGGAAGTTCCATTTTTCTCATCAATTGGGT
TTGTAACCTGTTTTTTGTGTTTCTTGATGAACCTTGCGGTTTCGCGGTTCTCATTGGCTC
TTTTTACTTGTGACATAATCCACGTTTGTCTCTTATCTTTCTGATATTATTATATATAAG
CAAAAAAACGAGGGAGTGTATAACGATAGTCCCTTCGGCTCTATTTTATTGTAAACCTCC
ACTACATTGTCATATTTGCGATGCCATTAGTATTTTATTGCAGAAAAATTTTTTTCAAAC
CACCCATACACCCTCATCGGAATCTTTTCATTTCAAAGCGACAGTAATATTTTCTGTCAA
GAATACACAAAGGATACACTTGCAGCTGGAATAAGCAAGATTCCACCAAGTTTCTTCTAC
CTGAAATACATCTATTACGGGGCCTTGATTAAAAGTAACTTAACTTCGCAGTTAAATTTA
ACTTTACAAGAACGGCATATGATCAGATCGTATCCTTGCCCGCTATCGGAGGGTCTCAGA
ATTACATCTTATACTGTTTCGAGTTTCTTATGTCTCCTCTTATAGCTAAAATGATTTGAA
CTTAGAAATTATCGAGGATAGAAGTAAGGCGTTGCATTTCCTTATAACTATCGTGTTTAT
TTTCTTAGTGGTGGTTCTTTTATTATTACCCGTTTTCTTCGGTAATATTTTATAGTGAAA
AATTTTGGTAAAAAAAAAAAAAAAGAAAAAATTTTTTTTATTTCAAATCTCATCTCATCT
CTTAAAAAGGTTTATTCTGTTTACTCAAACTCTTCATCAAAAACAAAAGTACTGCGCTAA
TAATTCTGGTCTTAGGTATCCATTAACTATACAGTGAACTTTATCCTTTTTCTGCTTTTT
TTTTGCCGTACTTCGATTATAATCAAAGCCAGAAAGAAAA
Chr coordinates Chr XV from 960987-965981
w3c xhtml validator w3c css validator