Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TYE7
Systematic Name YOR344C
Alias SGC1
Strain S288c
Description Serine-rich protein that contains a bHLH DNA binding motif; binds E-boxes of glycolytic genes and contributes to their activation; may function as a transcriptional activator in Ty1-mediated gene expression; bHLH stands for basic-helix-loop-helix
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>TYE7 YOR344C
ATGAACTCTATTTTAGACAGAAATGTTAGATCTAGCGAAACTACTTTAATTAAACCTGAA
TCTGAATTTGATAATTGGTTGTCGGATGAAAATGACGGAGCTAGTCATATCAACGTCAAC
AAGGACTCCTCGTCAGTTCTTTCTGCATCTTCTTCCACATGGTTCGAACCATTGGAAAAC
ATTATCTCCTCTGCATCCAGCTCCTCGATAGGCTCTCCAATCGAAGACCAGTTTATATCT
TCCAACAACGAGGAATCTGCTCTTTTTCCAACAGATCAGTTTTTCAGTAATCCTTCCTCA
TACTCGCATTCTCCCGAGGTTAGCAGCTCGATAAAAAGAGAAGAGGATGACAATGCCCTT
TCGTTGGCAGATTTTGAACCGGCTTCTTTGCAATTAATGCCTAACATGATAAATACTGAT
AATAATGACGATAGTACCCCACTTAAGAATGAAATCGAGCTAAACGACTCGTTTATAAAA
ACAAATCTAGATGCTAAGGAAACGAAAAAGAGGGCTCCAAGAAAAAGACTGACCCCCTTC
CAAAAGCAAGCTCACAACAAGATTGAAAAACGCTACAGAATAAACATCAACACAAAGATT
GCAAGACTGCAGCAGATTATCCCATGGGTAGCAAGTGAACAAACAGCTTTCGAAGTAGGT
GATTCTGTAAAAAAACAGGACGAAGACGGCGCAGAAACTGCCGCTACTACTCCTCTTCCA
TCTGCCGCTGCTACAAGCACGAAGCTAAATAAAAGCATGATCCTAGAAAAAGCTGTTGAC
TATATTCTATATCTACAAAATAACGAACGACTATACGAAATGGAAGTTCAAAGGTTGAAA
AGTGAAATCGACACTTTGAAACAAGACCAAAAATAA
Promoter Sequence
Download FASTA
>TYE7 YOR344C
TTCTATTATGCCAAAGCAAAAAAAAATCGGTGAAATAAACCTGTCTCAGTCTGGTTTAGG
AAAAGAGACATCACCACACCATGCCAAATGCGGCAACTTCCTTAAACCGCGGTGTCGTAG
AACCCATTCATCCTTGTGTATACGCTATGCTGGGCGGTACTTACCGGATCTGGCAGGCAC
CACATGGGTAGAGAATAAATGACGCACGCATCTGAATGTTACACCCAGAGGTATCCCGGA
AAATCTTCCTTTTGAAACCGGAACAAGCTGACCTTGACTTTCACCCGCGGATACTGCTTA
GCCCAGTTCCGGCCGTACACAAGCCCTTCTGGAGTGGGATTGAGCTCACTTCATTGCGCT
GTTACTCCCCTAACAACGTGGCCTCTCTCCATTCGGTAAGGAATCAAATTTTGTTCTAGA
ATGTTCATGCTGCTGCGGTCATTTCTTACCCTAGTAGTAATTCATTGTGCCCACGTACGA
ACCGTACAATGGGATTCTGCCCTGCGCACGTTCACAGTTCGCCAAATAACAATTCTCATT
TTCATTTCTTTTTCACAGTGTAGATGATACCGTGTCTGCGACATTTCCATTCTTAGTAGA
AATGCAAAACGCAACGTTTGCTATTAATTTTTTTCACCTCTGTTTCCTTTTTTTTTCTCA
CCTCAACAATCAAATGTACTTATATAAACTTCTTTTGTTATCTCCAAAATTTAAACTTAT
TTACATCCTTTTTCACTTCATATATCAATTCATGGGAAAGTAAAGCTATCTTAATTACAT
CCTTATTTTATATTTCCCAACCATCAACCTTTATTCTTTACATATTTCTCTCTTTTCTCA
TTTTCTTTCTTATTAAGCGTAAAGCACCACAAGCAGTACCGATCTAAAGTCTCTCTACTT
TACTATTATTTTTTTTTTTTGTTCACTTCATAAACTTTTAGTGCAAAAATAAAAATAAAG
ACAAATAACACACTATCAAATCTCTTCAAGTTTAACAATT
Chr coordinates Chr XV from 978069-977194
w3c xhtml validator w3c css validator