Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YOR345C
Strain S288c
Description Dubious ORF unlikely to encode a protein, based on available experimental and comparative sequence data; overlaps the verified gene REV1; null mutant displays increased resistance to antifungal agents gliotoxin, cycloheximide and H2O2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOR345C	6324922 upstream sequence, from -1000 to -1, size 1000
CGATTTTAATTGAAATTGCTCAAAGGTATATGGTAATGATATTAGTTTGATCCCATTTGG
CAACATCTTTTCAGCTTGAGACACCCACATTCCATTTTTAATCCCATATGACCTTGCTAC
ATAATTGCAACTAGCTATATCGGAGTTTTTAGTACCATGGCATACCACTATAGGATCCCG
TTTAAAATCACATGCTGAGAAACTAGAACTTCTACATAGATACGCAACAGTTGCAAAAAA
ACAGTCAAAATCGATATGAAAGATAATGTAGGTATCCTTATCCGTAATTTTGGTGTACTT
GTGGATGTTTTCATTCAGAAATTTATCTTTCAGATTGGCCTTCCATGCGGAGAGATGATG
TAATCTCGAATGAGCAAAATAGGAAGTAAGGAAATCAGGATCATCACAAGCGACTATCCT
TTTCGCCTCCAAATTATTGAGATTTACTGGTGACTGCTGTTCTACTGGCAACAATGCCGA
CCCTACACATTTAGATCCTTTGTGCAGGCTAGTCTCTGAGGGCAATGGAATTGAATTTAC
GGTTTTACAATTATCTAGTTTTTTTTGCTGTTCATCAAGTTTAGATGTTAACGAGTAATT
TTGCCAGGGCAATAATCTTGCTTCTTTGACGCTATCAACTATCCAATCCGGACTGACTAC
TTTGTAATTTGCAAATTCAATCCTTTTCTTTAATGGTAAATTGGAAGCCACTATGTGAGT
AACCGTTTTCTTTGAAGACAAATAGTGTAAAAATTTTCCGCCATGTAAAACTATCATCTC
GTGTAATTGCAGTCTTCCAGGTTTGGTGTAGCCATTTATATAGATGACGCAATTTTTGAA
TATTTTACTGCTTTGACTAGAAATTTGATCTTTATATTGATCTTTTAATATTTGATCTTG
CAGGGTTTGTCCGTGCGCCTTCTCGTGGAAATAAGCCTCCCTAGTATACACAGTATTTTT
TTTAACATCATCACCATTGCTATCACTTTCCTGGATCTCG
Chr coordinates
w3c xhtml validator w3c css validator