Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PUT4
Systematic Name YOR348C
Strain S288c
Description Proline permease, required for high-affinity transport of proline; also transports the toxic proline analog azetidine-2-carboxylate (AzC); PUT4 transcription is repressed in ammonia-grown cells
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PUT4 YOR348C
AGGGTGTAAAGTGCGTGTGGTGGCGTTCTTTCCAAAAATATTATCGTCTTTCCTTTTTTT
TTCTTTTTTTTTTTTTCAATAGTAATAGTATTTCCTAGTGATCTCGGCGATTTTCCTTGA
TTTCTCCAAAAGCGTTTTTACCCGGACGATATGAATCCATCTATTAAACATCATAACATC
ATATTATTTTTTTCTGTGCTTCTAAAACGGAGATCAAATACCGGGCCCGCGCGCGATGGC
CGGATGTCCGTCCATACTGCAATGTGAATTCCCGCGCGGTTCAAATCTTGTCACAAGTTT
GTCAAAATTGCTTGTCATGTCTGCCAAATCTCCAGGGTCCTAAATCTGAGGTAGCACGGC
ACGGCACAAGATGGTACCCATGGTGCGTGACGACAGCCGCTACTTGCACGGCTTTGTTCC
GGCAGCCCGGGTACCCGCGCTGCGAGTTGAAACATCATCAAACCAAAAGGGAAGCGACGT
TAGTTTTTTTCATTGCGCTAGCTATGACGTTTGGGTGGCCTAGCCGGTTCGCGTGTGCCT
GTCGCTTTTGTCGCTTTTCAACTTCTGCCCGATATTTCCTATCAAAGGAAAATGGGACGT
TTTCAACCCCTCGCTATCATCGTGCCTGCACTCTGCCTATCGCCAACTACACCGGGGTTT
TATCTGCTTCACCCCTCCATCCAGTGCTGATAACAAGAAGAACCTTGCAGGGTAGGGCAG
GACCTACGGCCAAAATACTAATTATGTCTGTTTATGTACATGCCCCAATCTGAATATTCC
ATGAATGTAGGCACAGCATATCTCCATCCATGTACTGATACAGACGCATAAACATATATG
TATATACATACTTATACACTCGAATATTTGTAGACTGATGTACTTCTATATATATATAGG
GGGTTTGTGTTCCTCTTCCTTTCCTTTTTTTTTCTCTCTTCCCTTCCAGTTTCTTTTATT
CTTTGCTGTTTCGAAGAATCACACCATCAATGAATAAATC
Chr coordinates Chr XV from 988782-986899
w3c xhtml validator w3c css validator