Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MEK1
Systematic Name YOR351C
Alias MRE4
Strain S288c
Description Meiosis-specific serine/threonine protein kinase, functions in meiotic checkpoint, promotes recombination between homologous chromosomes by suppressing double strand break repair between sister chromatids
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>MEK1 YOR351C
ATGAGACCGTTGTATAGCTGCAACCTTGCAACCAAAGATGATATTGAGATGGCAGGTGGC
GTAGCTCCTGCTCACCTGGAAGTTAATGTAGGCGGCTATAATACAGAGCAGACAATACCT
ATAGTAAAGCATCAGCTCGTGAAAGTTGGGAGAAATGATAAGGAATGTCAACTCGTTCTA
ACGAATCCCTCTATCTCCTCTGTTCATTGCGTGTTTTGGTGTGTCTTTTTTGATGAGGAT
AGTATTCCAATGTTCTACGTTAAAGATTGTTCTCTTAATGGAACGTATTTGAACGGTTTG
CTTTTGAAAAGGGACAAAACGTATCTTTTAAAACATTGCGACGTTATTGAATTATCGCAG
GGAAGTGAAGAAAATGACATTAAAAAAACACGACTAGTTTTTATGATTAATGATGATTTA
CAATCTTCTCTGGACCCAAAACTTTTAGATCAAATGGGTTTTCTGAGGGAAGTAGACCAA
TGGGAAATAACAAATAGAATAGTGGGTAATGGCACTTTCGGTCATGTTCTGATCACGCAT
AACTCAAAAGAACGTGATGAAGATGTCTGTTATCACCCTGAAAATTATGCTGTGAAGATC
ATTAAACTAAAACCAAATAAATTCGATAAAGAGGCTCGAATCCTTTTGAGACTGGATCAC
CCAAATATTATCAAAGTCTACCATACTTTCTGTGACAGGAACAATCACCTTTACATATTC
CAGGATCTTATCCCTGGTGGTGATTTGTTTTCTTACCTAGCTAAAGGCGACTGTCTAACT
TCCATGTCAGAAACTGAATCGCTATTGATCGTCTTTCAAATTTTGCAAGCTTTAAACTAC
CTTCATGATCAAGACATTGTTCACCGCGATTTGAAACTAGACAATATTTTGTTATGTACG
CCAGAACCGTGCACTAGAATCGTCTTGGCAGACTTTGGTATAGCTAAAGATTTAAATTCC
AACAAAGAAAGAATGCATACTGTCGTAGGCACTCCGGAATACTGCGCTCCAGAAGTTGGA
TTCAGAGCAAACAGAAAAGCATATCAAAGCTTCTCAAGAGCAGCTACGTTAGAGCAACGA
GGTTATGACAGTAAATGTGATCTTTGGTCTTTGGGTGTCATTACACACATTATGTTAACA
GGGATCTCGCCTTTTTATGGAGATGGTTCTGAGAGGAGTATTATTCAAAATGCAAAAATT
GGGAAGCTGAATTTCAAACTGAAGCAGTGGGATATTGTTTCAGATAATGCCAAGAGTTTT
GTCAAAGACCTTTTGCAAACTGACGTAGTTAAACGATTAAATAGTAAGCAAGGTCTCAAA
CATATTTGGATTGCAAAACACTTAAGTCAATTAGAGAGATTATATTACAAAAAGATATTG
TGCAATAACGAAGGCCCTAAACTAGAAAGTATAAATTCAGACTGGAAAAGGAAGTTACCC
AAAAGTGTTATCATTTCTCAGGCAATACCGAAAAAGAAGAAGGTTTTGGAGTAA
Promoter Sequence
Download FASTA
>MEK1 YOR351C
CTAGGCTGGAAATCGTCAACATCATCGAGCATAGTTACGTCGTTGATTGTGTTGTTAGTT
TCATTGTAAACATCATTGAATTCTGGTGTATGATATCTTCTTTTCTTATTACAATTACGC
TGCCATATAACGTTGTCTATGTTAGAATTTACGACATCACCTGAGTCTGCACTAATTTCT
ACATCTGAGTTTGGATCCAAGTTTAAATCATCAATGTCTTTTTCATCTAGATCATTTAAG
TTGTTCAAGTCCAGTTGCTCATTCGGTTGAGCATGTAATGGTGTGTTTGGCTCAGACATC
AAAATACTGTGTTGAAATCTTTTATTTTTATAATATTTCTTTCCTTACCAGGGCTTGGAG
TCTCTACAACAGTTAGCTTACTGTTTATTCTGCCACATTTCCACCCTTTTGTGGGGCTTC
TATTTCAAGGACCTTCATTATGGAAACAGGGCGAGGTTGTTTGTTCTTCCTGCATGTTGC
GCGCAGTGCGTAAGAAAGCGGGACGTAAGCAGTTTAGCCATTCTAAAAGGGGCATTATCA
GAATAAGAAGGCCCTATGAGGTATGATTGTAAAGCAAGTGGTGTAAAATTGTGTGCTACC
TACCGTATTAGTAGGAACAATTATGCAAGAGGGGTCCTGTGCAAATAAAAAATATATATC
TAGAAAAAGAGTAGGTAGGTCCTTCACAATATTGACTGATAGCGATCTCCTCACTATTTT
TCACTTATATGCAGTATATTTGTCTGCTTATCTTTCATTAAGTGGAATCATTTGTAGTTT
ATTCCTACTTTATGGGTATTTTCCAATCATAAAGCATACCGTGGTAATTTAGCCGGGGAA
AAGAAGAATGATGGCGGCTAAATTTCGGCGGCTATTTCATTCATTCAAGTATAAAAGGGA
GAGGTTTGACTAATTTTTTACTTGAGCTCCTTCTGGAGTGCTCTTGTACGTTTCAAATTT
TATTAAGGACCAAATATACAACAGAAAGAAGAAGAGCGGA
Chr coordinates Chr XV from 996511-995018
w3c xhtml validator w3c css validator