Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MEK1
Systematic Name YOR351C
Alias MRE4
Strain S288c
Description Meiosis-specific serine/threonine protein kinase; functions in meiotic checkpoint, promotes recombination between homologous chromosomes by suppressing double strand break repair between sister chromatids; stabilizes Hop1-Thr318 phosphorylation to promote interhomolog recombination and checkpoint responses during meiosis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>MEK1 YOR351C
ATGAGACCGTTGTATAGCTGCAACCTTGCAACCAAAGATGATATTGAGATGGCAGGTGGC
GTAGCTCCTGCTCACCTGGAAGTTAATGTAGGCGGCTATAATACAGAGCAGACAATACCT
ATAGTAAAGCATCAGCTCGTGAAAGTTGGGAGAAATGATAAGGAATGTCAACTCGTTCTA
ACGAATCCCTCTATCTCCTCTGTTCATTGCGTGTTTTGGTGTGTCTTTTTTGATGAGGAT
AGTATTCCAATGTTCTACGTTAAAGATTGTTCTCTTAATGGAACGTATTTGAACGGTTTG
CTTTTGAAAAGGGACAAAACGTATCTTTTAAAACATTGCGACGTTATTGAATTATCGCAG
GGAAGTGAAGAAAATGACATTAAAAAAACACGACTAGTTTTTATGATTAATGATGATTTA
CAATCTTCTCTGGACCCAAAACTTTTAGATCAAATGGGTTTTCTGAGGGAAGTAGACCAA
TGGGAAATAACAAATAGAATAGTGGGTAATGGCACTTTCGGTCATGTTCTGATCACGCAT
AACTCAAAAGAACGTGATGAAGATGTCTGTTATCACCCTGAAAATTATGCTGTGAAGATC
ATTAAACTAAAACCAAATAAATTCGATAAAGAGGCTCGAATCCTTTTGAGACTGGATCAC
CCAAATATTATCAAAGTCTACCATACTTTCTGTGACAGGAACAATCACCTTTACATATTC
CAGGATCTTATCCCTGGTGGTGATTTGTTTTCTTACCTAGCTAAAGGCGACTGTCTAACT
TCCATGTCAGAAACTGAATCGCTATTGATCGTCTTTCAAATTTTGCAAGCTTTAAACTAC
CTTCATGATCAAGACATTGTTCACCGCGATTTGAAACTAGACAATATTTTGTTATGTACG
CCAGAACCGTGCACTAGAATCGTCTTGGCAGACTTTGGTATAGCTAAAGATTTAAATTCC
AACAAAGAAAGAATGCATACTGTCGTAGGCACTCCGGAATACTGCGCTCCAGAAGTTGGA
TTCAGAGCAAACAGAAAAGCATATCAAAGCTTCTCAAGAGCAGCTACGTTAGAGCAACGA
GGTTATGACAGTAAATGTGATCTTTGGTCTTTGGGTGTCATTACACACATTATGTTAACA
GGGATCTCGCCTTTTTATGGAGATGGTTCTGAGAGGAGTATTATTCAAAATGCAAAAATT
GGGAAGCTGAATTTCAAACTGAAGCAGTGGGATATTGTTTCAGATAATGCCAAGAGTTTT
GTCAAAGACCTTTTGCAAACTGACGTAGTTAAACGATTAAATAGTAAGCAAGGTCTCAAA
CATATTTGGATTGCAAAACACTTAAGTCAATTAGAGAGATTATATTACAAAAAGATATTG
TGCAATAACGAAGGCCCTAAACTAGAAAGTATAAATTCAGACTGGAAAAGGAAGTTACCC
AAAAGTGTTATCATTTCTCAGGCAATACCGAAAAAGAAGAAGGTTTTGGAGTAA
Promoter Sequence
Download FASTA
>MEK1 YOR351C
CTAGGCTGGAAATCGTCAACATCATCGAGCATAGTTACGTCGTTGATTGTGTTGTTAGTT
TCATTGTAAACATCATTGAATTCTGGTGTATGATATCTTCTTTTCTTATTACAATTACGC
TGCCATATAACGTTGTCTATGTTAGAATTTACGACATCACCTGAGTCTGCACTAATTTCT
ACATCTGAGTTTGGATCCAAGTTTAAATCATCAATGTCTTTTTCATCTAGATCATTTAAG
TTGTTCAAGTCCAGTTGCTCATTCGGTTGAGCATGTAATGGTGTGTTTGGCTCAGACATC
AAAATACTGTGTTGAAATCTTTTATTTTTATAATATTTCTTTCCTTACCAGGGCTTGGAG
TCTCTACAACAGTTAGCTTACTGTTTATTCTGCCACATTTCCACCCTTTTGTGGGGCTTC
TATTTCAAGGACCTTCATTATGGAAACAGGGCGAGGTTGTTTGTTCTTCCTGCATGTTGC
GCGCAGTGCGTAAGAAAGCGGGACGTAAGCAGTTTAGCCATTCTAAAAGGGGCATTATCA
GAATAAGAAGGCCCTATGAGGTATGATTGTAAAGCAAGTGGTGTAAAATTGTGTGCTACC
TACCGTATTAGTAGGAACAATTATGCAAGAGGGGTCCTGTGCAAATAAAAAATATATATC
TAGAAAAAGAGTAGGTAGGTCCTTCACAATATTGACTGATAGCGATCTCCTCACTATTTT
TCACTTATATGCAGTATATTTGTCTGCTTATCTTTCATTAAGTGGAATCATTTGTAGTTT
ATTCCTACTTTATGGGTATTTTCCAATCATAAAGCATACCGTGGTAATTTAGCCGGGGAA
AAGAAGAATGATGGCGGCTAAATTTCGGCGGCTATTTCATTCATTCAAGTATAAAAGGGA
GAGGTTTGACTAATTTTTTACTTGAGCTCCTTCTGGAGTGCTCTTGTACGTTTCAAATTT
TATTAAGGACCAAATATACAACAGAAAGAAGAAGAGCGGA
Chr coordinates Chr XV from 996511-995018
w3c xhtml validator w3c css validator