Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TFB6
Systematic Name YOR352W
Strain S288c
Description Subunit of TFIIH complex; facilities dissociation of the Ssl2p helices from TFIIH; expression levels regulated by Arg5,6p; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and nucleus
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TFB6 YOR352W
AAACCGTTCAAATACGTTCCATTAAGAGAACAATCTTTAACGTAGAACATTGGAATACTA
TCCTCATCAAAAAAGACACACCAAAACACGCAATGAACAGAGGAGATAGAGGGATTCGTT
AGAACGAGTTGACATTCCTTATCATTTCTCCCAACTTTCACGAGCTGATGCTTTACTATA
GGTATTGTCTGCTCTGTATTATAGCCGCCTACATTAACTTCCAGGTGAGCAGGAGCTACG
CCACCTGCCATCTCAATATCATCTTTGGTTGCAAGGTTGCAGCTATACAACGGTCTCATT
CCGCTCTTCTTCTTTCTGTTGTATATTTGGTCCTTAATAAAATTTGAAACGTACAAGAGC
ACTCCAGAAGGAGCTCAAGTAAAAAATTAGTCAAACCTCTCCCTTTTATACTTGAATGAA
TGAAATAGCCGCCGAAATTTAGCCGCCATCATTCTTCTTTTCCCCGGCTAAATTACCACG
GTATGCTTTATGATTGGAAAATACCCATAAAGTAGGAATAAACTACAAATGATTCCACTT
AATGAAAGATAAGCAGACAAATATACTGCATATAAGTGAAAAATAGTGAGGAGATCGCTA
TCAGTCAATATTGTGAAGGACCTACCTACTCTTTTTCTAGATATATATTTTTTATTTGCA
CAGGACCCCTCTTGCATAATTGTTCCTACTAATACGGTAGGTAGCACACAATTTTACACC
ACTTGCTTTACAATCATACCTCATAGGGCCTTCTTATTCTGATAATGCCCCTTTTAGAAT
GGCTAAACTGCTTACGTCCCGCTTTCTTACGCACTGCGCGCAACATGCAGGAAGAACAAA
CAACCTCGCCCTGTTTCCATAATGAAGGTCCTTGAAATAGAAGCCCCACAAAAGGGTGGA
AATGTGGCAGAATAAACAGTAAGCTAACTGTTGTAGAGACTCCAAGCCCTGGTAAGGAAA
GAAATATTATAAAAATAAAAGATTTCAACACAGTATTTTG
Chr coordinates Chr XV from 997213-998244
w3c xhtml validator w3c css validator