Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSC6
Systematic Name YOR354C
Strain S288c
Description Multicopy suppressor of HER2 involved in mitochondrial translation; mutant is defective in directing meiotic recombination events to homologous chromatids
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSC6 YOR354C
AGGTAGGTATAGCAGACTTAGATATTGCGTGCGAATCAGTTTGATTCGCAAGTAAAATCT
TCATGCGCATTAGTATAGAGCGTTGGAAGCAGTTAACATAGTATTTCGGTTTTTTTTCCC
TTTCATAAAAAGGATTCTTCTTCCATAATCCCTTGCGTGAGTTGAATATGAATGAAACTC
GTTGAACTAGTGAACAACAAGTGATTGTATGCTCATATTTAGTACTAACATTTCAGCATT
GTATAATCCTTTCTTTACTTTCAGGATAAAGACATACATTCTACGTATGATCAAGAGTAA
GGAACAAGAATATTAAAAAAAACGAGATGAACCTTGAGTATATATATATATATTTACACC
AATGTGCCCTACGAAAATAGTGAAAAAAAAATTTCAGTTGCAACCGCGTTTTGTCCGTTA
GTATCTTTTGTCCGTACACCTCGTACTAAAAAAGAAAACCAGTCCAAAAAGAAAGTCAAA
CGGTCCAAATCGGAAACACCGACGCTCAGCTTAATAAACATTGTGTAGAGCCAAGCGGAA
AAGAATACCATTTAGCCGCCGATGCAGAAAACCGGTATATAGAGCTGAAAACAAAGATTG
AACTCTCCAGACAAGTTAGAAGTAAAAGCAAGTAATATATAAGTTTTATAAGTGAATATT
CGGTCGAAGGTAGTGTCAAAGTTACATCACCAAAACTACTTACTATTGAGGAAATATCAG
GTGTGCCAATACGTTAATTGATCTGTGAATAAAAAACGAAGTTGGAACATTGTATTACCT
TTCAAATATGCCATAAAAGGTTGCTCGTCGACTAAGTAATTAATCGATTATAAGAGGGAA
AAAGCGGGGTAAGTAAAATGTAATATCATCATATACGATATACATACCGCCTGTGGAATC
GTTCAATTGCTACACATGTCTAACTAAGGACGTACTGTCTATATGTTTGCTTAAGTTGGC
TCTGCACAAAATAATATCAGAGCCTTCCACTGGGATACAG
Chr coordinates Chr XV from 1003225-1001147
w3c xhtml validator w3c css validator