Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSC6
Systematic Name YOR354C
Strain S288c
Description Protein of unknown function; mutant is defective in directing meiotic recombination events to homologous chromatids; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSC6 YOR354C
AGGTAGGTATAGCAGACTTAGATATTGCGTGCGAATCAGTTTGATTCGCAAGTAAAATCT
TCATGCGCATTAGTATAGAGCGTTGGAAGCAGTTAACATAGTATTTCGGTTTTTTTTCCC
TTTCATAAAAAGGATTCTTCTTCCATAATCCCTTGCGTGAGTTGAATATGAATGAAACTC
GTTGAACTAGTGAACAACAAGTGATTGTATGCTCATATTTAGTACTAACATTTCAGCATT
GTATAATCCTTTCTTTACTTTCAGGATAAAGACATACATTCTACGTATGATCAAGAGTAA
GGAACAAGAATATTAAAAAAAACGAGATGAACCTTGAGTATATATATATATATTTACACC
AATGTGCCCTACGAAAATAGTGAAAAAAAAATTTCAGTTGCAACCGCGTTTTGTCCGTTA
GTATCTTTTGTCCGTACACCTCGTACTAAAAAAGAAAACCAGTCCAAAAAGAAAGTCAAA
CGGTCCAAATCGGAAACACCGACGCTCAGCTTAATAAACATTGTGTAGAGCCAAGCGGAA
AAGAATACCATTTAGCCGCCGATGCAGAAAACCGGTATATAGAGCTGAAAACAAAGATTG
AACTCTCCAGACAAGTTAGAAGTAAAAGCAAGTAATATATAAGTTTTATAAGTGAATATT
CGGTCGAAGGTAGTGTCAAAGTTACATCACCAAAACTACTTACTATTGAGGAAATATCAG
GTGTGCCAATACGTTAATTGATCTGTGAATAAAAAACGAAGTTGGAACATTGTATTACCT
TTCAAATATGCCATAAAAGGTTGCTCGTCGACTAAGTAATTAATCGATTATAAGAGGGAA
AAAGCGGGGTAAGTAAAATGTAATATCATCATATACGATATACATACCGCCTGTGGAATC
GTTCAATTGCTACACATGTCTAACTAAGGACGTACTGTCTATATGTTTGCTTAAGTTGGC
TCTGCACAAAATAATATCAGAGCCTTCCACTGGGATACAG
Chr coordinates Chr XV from 1003225-1001147
w3c xhtml validator w3c css validator