Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PIP2
Systematic Name YOR363C
Alias OAF2
Strain S288c
Description Autoregulatory oleate-specific transcriptional activator of peroxisome proliferation, contains Zn(2)-Cys(6) cluster domain, forms heterodimer with Oaf1p, binds oleate response elements (OREs), activates beta-oxidation genes
External source Open in SGD external link
Orthologs
Candida glabrata CBS138CAGL0J07150g
Zygosaccharomyces bailii IST302ZBIST_1578/ZbOAF1
Saccharomyces sp. 'boulardii' biocodexKO01_04492
Saccharomyces sp. 'boulardii' unique28AB282_04749
Kluyveromyces lactis NRRL Y-1140KLLA0_A03421g, KLLA0_A03443g
Yarrowia lipolytica CLIB122YALI0_F13321g
Kluyveromyces marxianus DMKU3-1042KLMA_30596, KLMA_30597
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PIP2 YOR363C
CTACCTTAGTGGAGGCAATCGTTGTTTTCATTTTGATTACAGTCTTGTTATCATCCGCAA
GCGTAAGAATATGGAGGAAGATGATCAAGTCTAAGAAAATATTTGGCCAGCCAAGCTATT
TACTCTTCAGTAGCTCGAAATTCTTAAACAAGTTCGGCTTTCTTTCCTCTCAATTTAAGT
CTACAAAAGTCTGGTGGTTAATGGCGACCTCTGCACACATGCTTATTAGGTCTATACTAG
TGGGTTCTCTACAAGCGCACGGAAAATCTCAATCTATTGGTATCTTTTTGAATGAAGCTA
TCTATCTCATCCTTTTGTGCTGGATGCAACCTTACATGGATAAAACAACCAACTTCTTCA
ATATTAGTATCCATTCACTGAATTTAGTGAACGCATTTTTTTTCTTATTTTTCAGTAACT
TATTTCAGCAGCCCATAGCTGTGTCTTCTTTTATGGGACTAATTTTCTTTTTTCTAAATG
CAGCGTTTTCTTTGTATCTCTTCATTTTCATATTGATATGCTTTACGATGGCAATATACT
ACAAACACCCTGATACAAGATACAAACCTATTGATGATCAAAGACGATCCTTTTTGAAGG
GTGAAATGGATGATGATGCGGTTTACGAATCGGTCCCGGAACTGCACGAAATGAAGAAAG
CCGTTCTTGAATGCAACGGTATTCAAAAGCCGCAGATCAATAAGATTGACCTTTGTAAAC
AAAATTCGAACTGTGAATATCTGTATATGTGAATAAATAAAATCGTGACTAATACGTCCG
GTAGGATTTGCCTTCCTGCAAAATTTCTTCTGATTTTGGAATTTGAAAGGTTGTAAGACC
ATCTCGGAACTAAATATAATCTCCGGAGTATCTCCAACGAAGAAAACATAAAGCGTTGTT
AGGACTTAATAGAGGTCAGATAAAGAAAATCTACTGAAACGTATAGAGCGGATGAAATAT
CACTTTCTGATCTTGCTGAACAAAATTTCTTCGATAAAAG
Chr coordinates Chr XV from 1023212-1020222
w3c xhtml validator w3c css validator