Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SCP1
Systematic Name YOR367W
Strain S288c
Description Component of yeast cortical actin cytoskeleton, binds and cross links actin filaments; originally identified by its homology to calponin (contains a calponin-like repeat) but the Scp1p domain structure is more similar to transgelin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SCP1 YOR367W
ACACATGCTAGAGGTTTGGTAAATTCTTTATCAATAGTGGAGTATGCTGTCACCACAATA
TATGCGTCTAAGTCAGGTATATTATATGTTATGCTTGGTATTTGGCTAGCTACCGCGGCC
TCAACATAATAACTTCCCATGAGTTCTATATTTCCCGGCTTCAACGGACATAATAAATTA
TCTTGGATTCCACATAGATCAAAAACTTTGGTATAAACATTGAGACCATATGCAATCAAT
TCTGCCTTGATGGTTATGTTTTCGCTCATAATTGTTTGTGCTTCAACATTAAAGAATAGA
GTATTATTTCTCGGGAAAAAAGCAGCTTCGAAATACGATGCAGAAAACTGTGAGTCTTTA
GCACAAGTCAACAGAGCCGAAGTCCTTAGATATTCTTTAGTATATGCATCAAATGGTACT
GGGAATAGAGTCGATGCGTTGTTCAGTAGTGTAAAAGAGTTAGAAACCTGGAAAGTAGAG
CTGTTAATGGAAATAGCGTGTATTTGTCGGAAGATTGCTAGCAAAACAAAAATCCGAGAT
AAAGAGAAGACTTTAATGGGAAGCATACTTATTCTCTTTACATCTATAAATCAGAGAGGT
TAAATATTATTTAAAATAGCATTACGACTTTGCTTCATCATCCTTCCAAAATATTGACAC
TGCATCATTTTTTAAATGTGTCAGTAATTCGGGCACAAAAATATAAATGGACCGCCATGA
ACTAAAGCTGTCGTCGATATGGATCGCTCCATAGCAGCATTATAAAAATTAAAAATGCAT
CAATACCATGCTACAGTAATAACAAAATACAGCATGGATTACCACTACATATTCATCATG
TCATGCATTATAGTTGTAACATATGCTGAACACCCATTCATCACGTGTAATTGGACATCC
GTGGAGTTCCAAAAGGAGTATAAACGCAAATAGTAAAGCTAAGATATAAGTAGTGTCTAA
GTAAATGACTTCTTTGTAAGCGTACAGCTAAAGTTTACCG
Chr coordinates Chr XV from 1026007-1026609
w3c xhtml validator w3c css validator