Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GDH1
Systematic Name YOR375C
Alias DHE4, GDH-A, GDHA, URE1
Strain S288c
Description NADP(+)-dependent glutamate dehydrogenase, synthesizes glutamate from ammonia and alpha-ketoglutarate; rate of alpha-ketoglutarate utilization differs from Gdh3p; expression regulated by nitrogen and carbon sources
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GDH1 YOR375C
AAGAATGACAGCTTCCCAAGTTATTCTGTAAAGTGTAATCTCGCATACAGTAGTTCAGCG
ACAGAAGCTTCGAAAACTTCTCTTAATGATGGACTCTTCGACAGTAACAAACTAGCACAC
CGAAGCTCCCGACAAGAAGGAGATGAACTTCTTTAGGTTCAAGTCCGCTAAACTCTACAG
TGATTCTGTCCAGCATTGGCTTTTTTTCTTGAATTATTCTAGCGGGCTGTGGCCAGTATA
CCAACCGAGCCAAACCATATTAGTAACTCCATTCAGTATAAAGTGGCACTGCTTCATGGG
GCTGCGATAAAGAGTCCTAGAAGACCATGCGTTCGAGTCGATCTGGGCACCACTCCGCAT
CTGGGCATAACCTGAATTATACAACAATAACGTGGGGGAGGGCATCGTTTACGATTGGCT
GGATAAGAGGATTTCATAAGGAATATGATGCTACATCCACTCAGGTCATTATTCTCTAGT
GTATCAGGCTCCCCTTATGCAGGTTCCATGACTCCATGGAAACGGGCCTGATCTTAATAA
CCTTATCTGACCATCTGATTGGATGGCCTCGATATTCTTATCGCAGAACCAATGCGCCGG
AACCGGCCCATGCATTTTCAGTGCGGTGGGGCAATAAAAAAGAAATAGTACGACCCCACG
TCCAATCAGCAGAGAGAAGCTGTTATCAGCTGCTGCGCCGTTTTCTTTTTCATCAGGTAC
CATAATGAAAATCAGCACTGAAAAATTGCGGAAGAAGAAAGCGTAAGAAGTAGCAGCAAA
GGCCGGCTTCTTGTTAAAGCAAAGTATACGTAATCTAAGTAAGAGAAGATTGGAAAATTT
TCTGTTTTTCATATATAAAATATACGAGAGTTACAAATGCGTTTACCCATTTTATATTCT
CTCACTCTTTAAATGACTTTTCTTATAGCATTGAAAGTTGCTTGATACGTACTATCGCAT
TATTCTAATATAACAGTTAGGAGACCAAAAAGAAAAAGAA
Chr coordinates Chr XV from 1043042-1041678
w3c xhtml validator w3c css validator