Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AMF1
Systematic Name YOR378W
Strain S288c
Description Putative paralog of ATR1, but not required for boron tolerance; member of the DHA2 family of drug:H+ antiporters; YOR378W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>AMF1 YOR378W
ATGTCAACTAGCTCCTCCGTAACGCAGAAAAACTTGGATACAAACGCGGAAGCCTTGAAA
AAGGAGGATAAAGTATTATCAGAGTTTGATATTCAGGATGAGAGGCCTAAATCCCTTTTA
TGGGAGAGTGCCTTTGTCGGAGTGCTGTGCTCTGCCCAACTAATGACTCAGGCAGGACTT
GGACAATCATTAGCGCCGCTTCACATCATCGGTAACAGTTTTGGAACAACGAATGCTGGA
CAACTTAGTTGGTTTGCTTCCGCATATTCGCTAACTGTTGGTACATTCATTTTAATTGCT
GGAAGACTCGGAGATATCTTCGGACACAAGAAATTCTTTGTCCTTGGCTTCTTTTGGTAC
GCACTTTGGTCCTTACTTGCTGGGTTTAGCGTCTACTCTAATCAGATTTTTTTTGACTGC
TGTCGTGCATTTCAAGGCATGGGTCCGGCCTTTTTGTTGCCAAATGCCATTGCGATTCTC
GGACGCACATATAAGCCAGGAAGAAGAAAAAACATGGTCTTTAGTCTGTTTGGTGCTTCA
GCACCTGGTGGCTTCTTCCTTGGGGCTGTTTTCTCATCCATGTTGGGTCAACTGGCGTGG
TGGCCATGGGCTTACTGGATAATGGGTATTGCATGCTTTGTTTTAGCTGTAGCAGGTTAC
TTTGTAATCCCTCACACCCCCATGCCAAGCCGCGATGCCTCATCTTTCAAGTTGTTGGAA
CGAATCGATTTTGCAGGGTCAGTTACCGGCGTTGTTGGATTAATTCTCTTTAATTTCGCT
TGGAACCAAGGCCCCGTTGTGGGTTGGCAAACTCCATACACATACGCTCTTTTGATAGTT
GGTACCTTTTTCTTGGTTATTTTTGCATATATCGAGTCCCGAGCAGCTTTCCCTCTGCTA
CCATTTGCTGCTCTTTCTAGTGATACTGCTTTTGTACTTAGCTGCATAGCTGCGGGATGG
GCCAGCTTTGGTATTTGGATATTCTATACATGGCAGTTCATGGAAGACTCAAGGGGCCAA
ACCCCCCTTCTTTCTAGTGCACAGTTTTCACCTGTAGCAATCAGTGGATTTTGTGCAGCC
GTGACGACAGGTTTCCTTCTAAGCCATACACCCCCAAGCACAGTTATGCTTTTTGCGATG
ACAGCTTTCACAGTCGGAACTATATTGATTGCTACGGCCCCCGTTCACCAAACGTATTGG
GCTCAAACGTTTGTGTCAATCATTGTTATGCCTTGGGGAATGGACATGTCCTTTCCGGCC
GCTACAATAATGCTTAGTGACTCGATGCCACACGAACATCAAGGTCTTGCAGCCTCTTTG
GTTAATACGGTGGTAAACTATTCGATATCGATAGGTTTGGGTATTGCAGGTACAATTGAA
TCTAGAGTAAATGACGGAGGTGCCAAGCCTTTGAAAGGATATCGTTGTTCGTGGTACATG
GGCATCGGGTTGAGCGGACTTGGCATTTTTGTCGCAGCAACGTATGCATGGAGCACTTTT
ATGAAGTCTAAAAAAAGGATCTCCGAAAAGCAGCATTTTATAGAATAA
Promoter Sequence
Download FASTA
>AMF1 YOR378W
ATATTTCATCAATTCGATATTATTGATATCGCACCTAATGTAGTCATTTCCTTTCTCTCT
TTGCTAGTAGATTTTAAAAAGGTTTCTTGCTGTATTTTTTTATACTTTTATAGACGCCGC
TTTCCAAAGTTCATCTAAAATAAGTCGCTACAATGATTTGATCTTGATTCGGTGCTTCAG
GAGCCTGCTTGCTTCTTTGCAGCTTCGGCAATTTGGAACCTTGTGTGCATATCCTCGTTT
GTAAGCCCAGAAGCACACAGACATCGATCACATCTATAATAGGAGCATGCTATCATAAAA
GATTCACAGTATTCGTATAATTACATGGCAGACTTTTTGAAAAGAATGGTATGGAACCAA
GTGAGCGCCTAGAAAAAAAGCTGAAAAGCTGAAATCTTAATTGGATAAGAAACTTCAATA
ACATTTTTCACGCGTTTCTTTTTCAACTAGATTAGCCTTAACAAACGACAATCATCGAGT
ACCCACGCTCATTACGCTGAACGTGCAAATGTAACGGGGTGGAAACCTAAAACGTTGAAT
GAACTAGCCAGAACGATGACAATTGCGGCAAGCTTTCCATACGTGTTCTGTTGTTGCGGC
TTAGAGTGGTAGGTAACCGCGCCAAGCAAAATTACCTACCACTTTAAGCCCAAAAAGGTG
ATGTGTAGCTATTGCGGCTGTGGCGGCTATTGCGGTTGTCGCCACGCTTGTCGCCAGGGT
TGTCGCTACGAATGTTTCAGCTTTTTTTTCAATGGGCCACTCTTTTCACGTGAAGCGCTC
CACGAAATGTGCGGATATTGCGGAAGCTCTCAATGATGAGCTATCGGTAGGGATTAAAAT
AAACGAGATTTGGCAGCAGTTTTAAATACCAAGGGAGTAGTATATCTAGCCTCCAATAAC
TTCATTTGTGGAAACTTACTTCTATCTCACTCTCTACCTGAAAAGAAAACAAATATTGTA
CATTCATCAATTGCTGGAACATAAAGAACATAAAATCAAT
Chr coordinates Chr XV from 1049511-1051058
w3c xhtml validator w3c css validator