Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FRE3
Systematic Name YOR381W
Strain S288c
Description Ferric reductase, reduces siderophore-bound iron prior to uptake by transporters; expression induced by low iron levels
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FRE3 YOR381W
TATCAGTTAATTATAGGAGTACAGCCTTTTATAGAGTTGGCGAAGATAGCCAAAAGATAA
AAGCTTTGACGTACGTCTGTAAAAAGTGCCTTTTCTGATCGAATCCAGTTGCTCAGATAT
CCGGGAAGTTGTTAGCATTCATTGCTTTTCTGCACTATATCAGCATATGAATGCTTTCAG
TATTTTAATTTTACCCTTTCACGAAGTACGCCAGAAAATGATTGGAAACGTACTCAAAAA
CAAAGCAGGAAATAAGCGACGAAAATTTTTCATTTCAATTAAGAGGTACTGAGCGGCTAC
TTAACTTTTTCTGCAGTAAGTAATGACAGAGTATCACTACAGAATTCTGTGCCTCCGGTC
TGGGAATGCAGCTAGGGAGACAGCACCCTTTTGCTAATAATGCGCCGGAAATGAAACATT
TAGATAAAATCTAAAGTTACGAAAACAATACACTTTGAGGGAAAGATATCAGAGAATTAA
AAGCTGCAAAGAACTATGACAAATTAACCGCTTTGTTGACCCTAGATCATAGTTTACACT
GCGAACGGGATAGTTGCAACCTCTTTTGTAAAATGCACCCATATCTCATTTTGCCTTTAT
TTCGGGTGTATAATAGGAGAAAAATTTGAATGGTAAAGAATAAGTCCCTTGCGAGTGTCA
AGAGAAGCACAATTATTATTACTATTGGTGACGTGATTGAACTCGAGAATTTTCCTGGAC
CGATATTTGAGTTTTACGTGGAATGTGGGTGTACCTCATCTCAAAGAATTGGCGAAAAGC
CAAACTTCTTAATTCTAACAAAAGCTACTGATTCGTTGGCGATGAAAGACTCTTTTTTTT
GGCTGTCAGAAGCTTTCATCTTTGACATAGATGTACAGAATTTGATCAATTGTTTATATT
AAAAGATTCGTCGCAACTTATATAAGGTGGCAAGAGAATGATTAACTTCAATTGCTGATG
AACGTTCTCAATTCAAAAATTATAAGACACAAGGAAAACA
Chr coordinates Chr XV from 1055545-1057680
w3c xhtml validator w3c css validator