Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FIT2
Systematic Name YOR382W
Strain S288c
Description Mannoprotein that is incorporated into the cell wall via a glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore-iron in the cell wall
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FIT2 YOR382W
ACGCAAGACAACAGGCAAAATAATTTCGTTTCTCAGTACCGAAATGACGAAATATACTGA
GGCAAATGCGATCATCATGCCTTTGCGCCAAGAAACTCCCTTGTGAAGAACTTCAAACCG
AAATGGGAAAACTTTGAGTTATTGACAGGGAATACGGAGGGGAAGATCACACTTAAATCC
GTATGAGCCGCGCACATAATGGTATTCAAATACACAAGAACATTCATGAGCTATTTTTCA
TCCGTGCAAACGAATTTACTACAATTGGACCAGAGGGCACCATAACTGGAGACTTTGCTA
CTGACTCAACGTTGATGATGCGAGTAGTGGGTGTACTGTGATTTGCTCATTTTTTTTTTT
ATAGAAAGATTCGATTAATGAAAGTCACAGGAGACATTTTTACATAGACATTCCGTATAT
GTTGCGGGTATCGCGGATGCGGATTAGTGATGCCTTTAACTACATTTCATAGATTTCTGT
ATACCAATTGAAATGAGTGAAGTAAGCTCCTACAGTGAAATATCTGGGTGCTACTGACGC
CAAGCCCTACAGCGATCGGAATGCGGGAACGGAAGTTAACGGGGCTTCCAGAACGGCGGA
AGCGAATTGAACGAGGACGGCAAACAAAAACACCCAAAATTTCATTACTTAGAATGACCC
TCAAGAGCAGGGTGCAATTTATCAAGCGATCATTGAACTAACTAAGTTCATATCCTGTAT
AGGATTTAAAACAATGCACCCTAAGTTCAAATGCACCCCCCCTCGCCCCGCAGCGGACCC
TTGAACAGAGAACTGTTTCGAGGTTCACCCAATTGGATCACTTGTATAATTTGTAATCGA
GTTCGGATAAGATGTATACGAATCTAACTGGGTGCAGTATAATTAGCATTTTATATTACC
TAGCAATATATGTATAAAACAGGAATGTGTGCGTGCTTCAGGCAGAATTTTACGGTCCTT
GTAAAAAAGTCTATCATAAAGCCATCACAAAACAATAATA
Chr coordinates Chr XV from 1059531-1059992
w3c xhtml validator w3c css validator