Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FIT3
Systematic Name YOR383C
Strain S288c
Description Mannoprotein that is incorporated into the cell wall via a glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore-iron in the cell wall
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FIT3 YOR383C
TCCATAAACATTTCCTTTGTCTATATTATCCAGGGGCCCAAAATAAGCCCATACCCACCT
ATCTAGAGAGGCTTTATTGGGAGTGACGGGATATCGTATGTTTTCCTTTACCTCATCAAG
AGGCCGGATGAAAAGGGATGCATTGGCAAAAATTCGATAATACTCCTCATTGCTGACGAC
CTCATCTTTGTGATAATCGTGGCAATACTGATTAATTTTGCTAAACGTTTTTTCGAATAT
TTTTTTACTTTTCTTCCTACTGTCGAGAACATCCTTCGCGCAATGTAACCAAGACCCTAG
TGCTGGTTCATAAGTGCAAAGAGTAGCGTGCCGACCCTTCACATCCGTGTCAAATTTGTG
TGATTCCAATTCTTTAGCACAAGCATCAATTGCTATCTGGTCCCATTGCGTTCTTTTCTT
AGTTGATGCTGGTTTTGCTAAAGAACCTGGTGCCAAATACACCAACAGCAGCACTAATCT
AGCGAAAAGCATTCGAAATCTGGGTGAATTAAATTAACTGCGACAAAATTGGTGATGTGA
CATACCGAAAACGCTACATTACACATTTGCCAAGTAAAAAATTGACGCTCCTTTTTTAAT
GATCGCTAATGTAATGAAAAGTAAAAATCCAATTAAACGAGGAAGCGGTAAAATATGATT
GCTGTGTAGTAATGCCACAGTCTTCTTAGTCCTACCTATGTCCTAGATTTTTTTTTGCAC
CCTGTTTGTTCCGCACCCCGCTATCCCATATTTTTTGATGTATGTGAAGGAAAGCAATCT
AAGGGCTCAAGAGCCGAGTTCCGCCATTCTAGGAAAGGGTGCAAAAAAATGGGGTTCAAT
TATCGTTCGAGATTTGTTATTTTTTTTTTTGTAAAAGTTGATTTATGGGGTATTTAAGCC
AAGAACTATTTGAAGTATTAGGAGGTAATATGAATGTTCGAACAGATACAAACAAGTACT
TCCACTCGCTTAAAAATAACTAATAACAATAATCCCTAAA
Chr coordinates Chr XV from 1061055-1060441
w3c xhtml validator w3c css validator