Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FDH1
Systematic Name YOR388C
Strain S288c
Description NAD(+)-dependent formate dehydrogenase, may protect cells from exogenous formate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FDH1 YOR388C
GCAAGTGACATGAACACTGTAATACATCACATTGGTAAACAAAGCTTGAATCGTGAACCT
TTCTCTAAAAATTTCGATAATATGCATAAAGGTTCTTGAAGCTCCCCTTGTTCAAGTGGT
TTATTTTTCTATAGATATTTACACTCCGCAAGTGCAAAAAAAAAGCATTATCGCTAACGA
TCAAGAGGAACTGAGACCTTATTAGTTGTCTTTGTTGGCGTAACATAAATTTCTTAGGAA
AAGAGAAAATTATCTCGAAGGCAAAAATAAACCAAGCCTCGAGTTTAATGGTTTTCTAAA
AAACACTTTAAAAACAGATCGCCATAAAAGGAGAAGCTCCGTAGGAGACCGTTTTCGAAA
CCTATGTAGAAATAAAGGGAAAGCTCCAACGGTTTGGATAAATCTTTAGAAGCATAGAGT
TTATACAACATTCAGTACGAAATGTACTCTCGAAACGTTCTCTTTTCACGGTGCTTAGTA
GCAGAAAAAAGTGTCGGAAATTACCTATTTTGTCACCACTCGAGGATAGGCTTGAAAGAG
AGTTTTAACCCCAACTTTTCTATTTTGCACTTGTTTGGCTATGGTTTAAAACATTCTGTT
TGGACCAACAGCCCAAGCGGCTTATCCCTTTTCTTTTTTTCCCTTATAATCGGGAATTTC
CTTACTAGGAAGGCACCGATACTAGAACTCCGAATGAAAAAGACATGCCAGTAATAAAAC
TATTTTGATGTTATGCGGAATATACTATTCTTGGATTATTCACTGTTAACTAAAAGTTGG
AGAAATCACTCTGCACTGTCAATCATTGAAAAAAAGAACATATAAAAGGGCACAAAATTG
AGTCTTTTTTAATGAGTTCTTGCTGAGGAAAGTTTAGTTAATATATCATTTACGTAAAAT
ATGCATATTCTTGTATTGTGCTTTTTTTATTCATTTTAAGCAGGAACAATTTACAAGTAT
TGCAACGCTAATCAAATCAAAATAACAGCTGAAAATTAAT
Chr coordinates Chr XV from 1072923-1071793
w3c xhtml validator w3c css validator