Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YOR394C-A
Systematic Name YOR394C-A
Strain S288c
Description Identified by gene-trapping, microarray-based expression analysis, and genome-wide homology searching
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOR394C-A YOR394C-A
TCATCATCTAAGAATGTAATAATTAAGCTACTCTATTGAGAAGAAGCAGAATCTGCGCTA
TGCAGGTGCAAATCTCCAGCAGCAGCAAAGAAAATTCAGTTAATAAGAAATCTCACTAAG
ATAAGCGACTGTCTGTCCCAACATAGAAAACAGAAGGATGTCTCATTCATCGCTTGATTT
CCGGCCTGCAAAAATAAAGTAGTCGGTACGTACTTTCGTTTTCAATTTCCATGGTGCACA
GTATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAGCCGCTT
CGTGGATATTCTCTTGGATACTTTAAATATGGACCTACGCTTAGCCTGCGCTTAGCCTAC
AACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTATAAATTACATTTCCTTAT
TAGGTATACGACCTCGCGCTTCGAAGTAGAGGAGCCCTTTTTGGCGTACCTACATATGGC
GCGTCAGACAGACAAACTTCCCCCAAAAATGTATTACCCCGCCGAATAAGAAAACAGACC
CATTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAAAAATTC
CTTGACGCTAGATCGTTGGACTAAAATCTGCGTCACAATCGCCTAAACAGGAAATATTGC
CTATTTTCGTACAAGGTTACTTCCTAGATGCTATATGTCCCTACGGCCTTGTCTAACACC
ATCCAGCATGCAATACAGTGACATATATATGATGAACCTGTCTCTCAACTTACCCTCCAT
TACCCTACCTCTCCACTCGTTACCCTGTCTCACTCAACCATACCACTCCCAACCACCATC
CATCTCTCTACTTACTACTACCATCCACCGCCCATCATAACCGTTACCCTCCAATTACCC
ATATCCAACTCCACCACCACTTACCCTACTATTACCCTACCATCCATCATCCGCTACTCA
CCATACTGTTGTTCTACCCACCATGTTGAAACGTTAACAA
Chr coordinates Chr XV from 1084369-1084202
w3c xhtml validator w3c css validator