Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HAT1
Systematic Name YPL001W
Alias KAT1
Strain S288c
Description Catalytic subunit of the Hat1p-Hat2p histone acetyltransferase complex that uses the cofactor acetyl coenzyme A, to acetylate free nuclear and cytoplasmic histone H4; involved in telomeric silencing and DNA double-strand break repair
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HAT1 YPL001W
ATTCCTGTTCAAGTCAACTATCTCACAGTTGCCTCGTAATCCAAGAGGGATCCCAATACA
ACGCCTCTGCACCACCTTGATAATCAATCCACAATAAACCGTTAGCGACCATTTCATCAA
GAGCAGATTTACTCCTAACAGCCTCCCATCCCAAGTTTGCCTTTAATAAAGAGATACTTG
AGTAGCCCAGAATTGAGCATATTTCCAAAATCTTTGTTTGATCTGATGTCAACTCATTTG
GAACACTTCGTAAAAACTTTTTGCCGCGAATTTGAAATATCTCAAAACACTCTAGGCTCT
TTAGCATGTCGATAGATTTTTCCAAATCATCGAGTCCAACATTCAGCTTACGAAAATGCA
CCTTCTCCAACTCTTGAAAAGAAATGACGCCTCCATTCATATCTTTAGTTTGCCGACAAA
TTTCTATAACTTTAAGACATACTTCATAATAAAAATCATTCACTGTAAATAAGTGCTTAT
CTCGATCAAATAAAGATAGGGGATCAATCCCAATAGATGAGCACATATGCATGAATTTTG
AGCGGAATTCAGGTGAAGCTTGAAGCTCGCTATTGTGTTTCTTGGCAAATTCTACCAGTC
GTTCTTGGAATACCATTAATTGGTCCCTTAGTTCGACAGATTGCTTTTCAAGTATGGTTT
TGTTTACGTCATTGTACTTTCCATCCTTCAACTCGTCAAAGGCTGCCAGTCCAAACTGTT
TCATGTTAGTGAGTTTCGAAGTTGGCTGTTACGCCAAGCATTTTCAAGTCGTGGTAAAGT
CTTTGGTCTACTGCATCGCCTCAAAAGGTTATAATATATCCCAGAATTGATGGATTAAGT
TCTTGAAATAGCACACCGTTATAAGTGATAAATATATTGTCTTCGAATAACGAATTTATT
AGATTTCTATGTATTTCTACTTGAAGTTAGGAATAGATCTTTCTGGAATTGTTTTCAGCA
AAATTATGCTTAAGCTATAACTATAGTGAGAATCAAGAAT
Chr coordinates Chr XVI from 554605-555729
w3c xhtml validator w3c css validator